ClickCease
+ 1-915-850-0900 spinedoctors@gmail.com
דף בחר

מתח חמצוני

מרפאת גב צוות כירופרקטיקה ורפואה תפקודית מתח חמצוני. עקה חמצונית מוגדרת כהפרעה באיזון בין ייצור חמצן תגובתי (רדיקלים חופשיים) לבין הגנה נוגדת חמצון. במילים אחרות, מדובר בחוסר איזון בין ייצור רדיקלים חופשיים ליכולת של הגוף לסתור או לנקות את ההשפעות המזיקות באמצעות נטרול על ידי נוגדי חמצון. מתח חמצוני מוביל למצבים פתופיזיולוגיים רבים בגוף. אלה כוללים מחלות ניווניות של עצבים, כלומר מחלת פרקינסון, מחלת אלצהיימר, מוטציות גנים, סרטן, תסמונת עייפות כרונית, תסמונת X שביר, הפרעות לב וכלי דם, טרשת עורקים, אי ספיקת לב, התקף לב ומחלות דלקתיות. חמצון מתרחש במספר נסיבות:

התאים משתמשים בגלוקוז כדי לייצר אנרגיה
המערכת החיסונית היא להדוף חיידקים ויצירת דלקת
הגופים לניקוי רעלים, חומרי הדברה ועשן סיגריות
ישנם מיליוני תהליכים המתרחשים בגופנו בכל זמן נתון שיכול לגרום לחמצון. הנה כמה תסמינים:

עייף
אובדן זיכרון או ערפל המוח
כאבי שרירים או מפרקים
קמטים עם שיער אפור
ירידה בראייה
כאבי ראש ורגישות לרעש
רגישות לזיהומים
בחירת מזונות אורגניים והימנעות מרעלים בסביבה שלך עושה הבדל גדול. זה, יחד עם הפחתת הלחץ, יכול להיות מועיל בהפחתת החמצון.


ההשפעה המלחיצה של הומאוסטזיס של הגוף

ההשפעה המלחיצה של הומאוסטזיס של הגוף

מבוא

כולם מתמודדים עם לחץ בשלב מסוים בחייהם. בין אם זה יהיה ראיון עבודה, דד-ליין ענק, פרויקט או אפילו מבחן, לחץ קיים כדי לשמור על תפקוד הגוף בכל תרחיש שהגוף עובר. מתח יכול לעזור לווסת את הגוף המערכת החיסונית ועזרה מטבוליזם הומאוסטזיס כאשר הגוף מגביר את האנרגיה שלו במהלך היום. כאשר מתמודדים עם מתח כרוני יכול לגרום להפרעות בתפקוד מטבולי בגוף כמו הפרעות במעיים, דלקת, ועלייה ברמות הגלוקוז בדם. מתח כרוני יכול להשפיע גם על מצב הרוח והבריאות של האדם, הרגלי האכילה ואיכות השינה. המאמר של היום יבדוק אם מתח הוא דבר טוב או דבר רע, כיצד הוא משפיע על הגוף, וההשפעות של מה שמתח כרוני עושה לגוף. הפנה מטופלים לספקים מוסמכים ומיומנים המתמחים בטיפולי מעיים לאנשים הסובלים מנוירופתיה אוטונומית. אנו מנחים את המטופלים שלנו על ידי הפניה לספקים הרפואיים הקשורים לנו בהתבסס על בדיקתם כאשר הדבר מתאים. אנו מוצאים שחינוך הוא קריטי לשאילת שאלות בעלות תובנות לספקים שלנו. ד"ר אלכס Jimenez DC מספק מידע זה כשירות חינוכי בלבד. כתב ויתור

 

האם הביטוח שלי יכול לכסות זאת? כן, ייתכן. אם אינך בטוח, הנה הקישור לכל ספקי הביטוח שאנו מכסים. אם יש לך שאלות או חששות, אנא התקשר לד"ר חימנז בטלפון 915-850-0900

02 LaValle Triad 1 בלוטת יותרת הכליה לבלב

האם סבל ממתח טוב או רע?

 

האם אתה מרגיש חרדה כל הזמן? מה דעתך להרגיש כאבי ראש שהם כל הזמן מטרד? מרגישים מוצפים ומאבדים מיקוד או מוטיבציה? כל הסימנים הללו הם מצבי לחץ שאדם עובר. מחקרים הגדירו מתח או קורטיזול כהורמון הגוף המספק מגוון השפעות על תפקודים שונים בכל מערכת. קורטיזול הוא הגלוקוקורטיקואיד העיקרי שמגיע מקליפת יותרת הכליה. במקביל, ציר HPA (היפותלמוס-יותרת המוח-אדרנל) עוזר לווסת את הייצור וההפרשה של הורמון זה לשאר הגוף. כעת קורטיזול יכול להיות מועיל ומזיק לגוף, בהתאם למצב בו האדם נמצא. מחקרים נוספים הזכירו שקורטיזול מתחיל ומשפיע על המוח ועל שאר הגוף שכן מתח בצורתו החריפה יכול לגרום לגוף להסתגל ולשרוד. התגובות החריפות של קורטיזול מאפשרות תפקוד עצבי, קרדיווסקולרי, חיסוני ומטבולי בגוף. 

 

איך זה משפיע על חילוף החומרים של הגוף?

כעת קורטיזול משפיע על חילוף החומרים בגוף כאשר הוא נשלט במחזור שינה איטי ויציב שמפחית את ההורמון המשחרר קורטיקוטרופין (CRH) ומגביר את הורמון הגדילה (GH). מחקרי מחקר הראו שכאשר בלוטות יותרת הכליה מפרישות קורטיזול, היא מתחילה לקיים אינטראקציה מורכבת עם ההיפותלמוס ובלוטת יותרת המוח במערכת העצבים והאנדוקרינית. זה גורם לתפקוד יותרת הכליה ובלוטת התריס בגוף להיות קשור קשר הדוק תוך שליטה של ​​ההיפותלמוס וההורמונים הטרופיים. בלוטת התריס מתחרה עם איברי יותרת הכליה על טירוזין. מחקרים מצאו כי טירוזין משמש לייצור קורטיזול במתח תוך מניעת ירידה בתפקוד הקוגניטיבי המגיב ללחץ פיזי. עם זאת, כאשר הגוף אינו יכול לייצר מספיק טירוזין, זה יכול לגרום להיפותירואידיזם ולגרום להורמון הקורטיזול להפוך לכרוני.


סקירה כללית על מתח-וידאו

האם חווית כאבי ראש שמופיעים באקראי משום מקום? האם כל הזמן עלית במשקל או ירדת במשקל? האם אתה מרגיש חרד או לחוץ תמיד שזה משפיע על השינה שלך? כל אלה הם סימנים ותסמינים של רמות הקורטיזול שלך שהופכות למצבן הכרוני. הסרטון שלמעלה מראה מה מתח עושה לגוף שלך וכיצד הוא יכול לגרום לתסמינים לא רצויים. כאשר יש סטרס כרוני בגוף, ציר ה-HPA (נוירו-אנדוקריני) אינו מאוזן עקב המפעילים המתווכי-סטרס המעורבים במחלות אוטואימוניות של בלוטת התריס (AITD). כאשר יש לחץ כרוני בגוף, זה יכול לגרום לייצור מוגזם של תרכובות דלקתיות בגוף יכול ליצור IR. החומרים הדלקתיים עלולים לפגוע או להשבית את קולטני האינסולין מה שמוביל לעמידות לאינסולין. זה תורם לפירוק של גורם אחד או יותר הדרושים להשלמת תהליך הובלת הגלוקוז בגוף.


ההשפעות של קורטיזול כרוני בגוף

 

כאשר יש לחץ כרוני בגוף ולא טופל או מופחת מיד, זה יכול להוביל למשהו המכונה עומס אלוסטטי. עומס אלוסטטי מוגדר כשחיקה של הגוף והמוח עקב פעילות יתר כרונית או חוסר פעילות של מערכות הגוף המעורבות בדרך כלל באתגרים סביבתיים והסתגלות. מחקרי מחקר הראו שעומס אלוסטטי גורם להפרשה עודפת של הורמונים כמו קורטיזול וקטכולמין להגיב לגורמי לחץ כרוניים המשפיעים על הגוף. זה גורם לציר HPA לעשות אחד משני דברים: להיות עמוס יתר על המידה או אי כיבוי לאחר אירועים מלחיצים הגורמים להפרעות שינה. בעיות אחרות שמתח כרוני גורם לגוף יכולות לכלול:

  • הפרשת אינסולין מוגברת ושקיעת שומן
  • שינוי בתפקוד החיסוני
  • תת פעילות בלוטת התריס (תשישות אדרנל)
  • שימור נתרן ומים
  • אובדן שנת REM
  • חוסר יציבות נפשית ורגשית
  • עלייה בגורמי סיכון קרדיווסקולריים

תסמינים אלו גורמים לגוף להיות לא מתפקד, ו מחקרים הצביעו על כך שגורמי לחץ שונים עלולים לפגוע בגוף. זה יכול להקשות מאוד על אדם להתמודד עם לחץ ולהקל עליו.

סיכום

בסך הכל, מתח או קורטיזול הוא הורמון שהגוף צריך כדי לתפקד כהלכה. מתח כרוני בגוף כתוצאה מגורמי לחץ שונים עלול לגרום להפרעות מטבוליות רבות כמו תת פעילות של בלוטת התריס, עלייה במשקל, תנגודת לאינסולין ותסמונת מטבולית, אם להזכיר כמה. מתח כרוני יכול גם לגרום להפרעות שינה מכיוון שציר ה-HPA מחווט ונראה כאילו הוא נרגע במעט. כאשר אנשים מתחילים למצוא דרכים להתמודד עם גורמי הלחץ השונים הללו, הם יכולים להפחית את רמות הלחץ שלהם בחזרה לנורמליות ולהיות נטולי מתח.

 

הפניות

ג'ונס, קרול וכריסטופר גוונין. "חוסר ויסות ברמת קורטיזול ושכיחותו - האם זה השעון המעורר של הטבע?" דוחות פיזיולוגיים, John Wiley and Sons Inc., ינואר 2021, www.ncbi.nlm.nih.gov/pmc/articles/PMC7749606/.

McEwen, Bruce S. "השפעות מרכזיות של הורמוני סטרס בבריאות ובמחלות: הבנת ההשפעות המגנות והמזיקות של מתווכי מתח ולחץ." כתב העת האירופי של פרמקולוגיה, הספרייה הלאומית לרפואה בארה"ב, 7 באפריל 2008, www.ncbi.nlm.nih.gov/pmc/articles/PMC2474765/.

מקיוון, ברוס ס. "לחוץ או לחוץ: מה ההבדל?" כתב העת לפסיכיאטריה ומדעי המוח: JPN, הספרייה הלאומית לרפואה בארה"ב, ספטמבר 2005, www.ncbi.nlm.nih.gov/pmc/articles/PMC1197275/.

Rodriquez, Erik J, et al. "עומס אלוסטטי: חשיבות, סמנים וקביעת ציון באוכלוסיות מיעוט ופערים." Journal of Urban Health: עלון של האקדמיה לרפואה של ניו יורק, ספרינגר ארה"ב, מרץ 2019, www.ncbi.nlm.nih.gov/pmc/articles/PMC6430278/.

תאו, לורן ועוד. "פיזיולוגיה, קורטיזול - Statpearls - מדף הספרים של NCBI." בתוך: StatPearls [אינטרנט]. אי המטמון (FL), הוצאת StatPearls, 6 בספטמבר 2021, www.ncbi.nlm.nih.gov/books/NBK538239/.

יאנג, סיימון נ. "ל-טירוזין כדי להקל על השפעות הלחץ?" כתב העת לפסיכיאטריה ומדעי המוח: JPN, הספרייה הלאומית לרפואה בארה"ב, מאי 2007, www.ncbi.nlm.nih.gov/pmc/articles/PMC1863555/.

כתב ויתור

סוכרת ומתח קשורים בגוף

סוכרת ומתח קשורים בגוף

מבוא

מכיוון שהעולם בתנועה מתמדת, אנשים רבים צריכים לסבול מצבים מלחיצים משפיעים על גופם ובריאותם. הגוף צריך הורמונים כמו קורטיזול להמשיך לתפקד כפי שזה משפיע על מערכת החיסון, העצבים, הלב וכלי הדם והשרירים והשלד, אם להזכיר כמה. תפקיד חיוני נוסף שהגוף זקוק לו הוא גלוקוז, הדורש אנרגיה כדי להיות בתנועה מתמדת. מצבים שגורמים לרמות הקורטיזול ולרמות הגלוקוז לעלות בגוף עלולים להוביל לבעיות כרוניות כמו סוכרת ומתח כרוני. זה גורם לאדם להיות אומלל ולהיות במצב רציני אם לא נשלט עליו מיד. המאמר של היום בוחן כיצד קורטיזול וגלוקוז משפיעים על הגוף ואת הקשר השזור בין מתח וסוכרת. הפנה מטופלים לספקים מוסמכים ומיומנים המתמחים בניהול מתח וטיפולים אנדוקריניים עבור אנשים עם סוכרת. אנו מנחים את המטופלים שלנו על ידי הפניה לספקים הרפואיים הקשורים לנו בהתבסס על בדיקתם כאשר הדבר מתאים. אנו מוצאים שחינוך הוא קריטי לשאילת שאלות בעלות תובנות לספקים שלנו. ד"ר אלכס Jimenez DC מספק מידע זה כשירות חינוכי בלבד. כתב ויתור

 

האם הביטוח שלי יכול לכסות זאת? כן, ייתכן. אם אינך בטוח, הנה הקישור לכל ספקי הביטוח שאנו מכסים. אם יש לך שאלות או חששות, אנא התקשר לד"ר חימנז בטלפון 915-850-0900.

01 LaValle אבחון מתקדם ב-DM ומתח

כיצד קורטיזול משפיע על הגוף?

 

האם חווית בעיות שינה בלילה? מה לגבי כאבי ראש תכופים המהווים מטרד לאורך כל היום? או האם שמת לב לירידה מוגזמת במשקל או לעלייה במשקל סביב האמצע שלך? חלק מהתסמינים הללו הם סימנים לכך שרמות הקורטיזול והגלוקוז שלך גבוהות ויכולות להשפיע על הגוף שלך. קורטיזול הוא הורמון המיוצר במערכת האנדוקרינית ויכול להועיל או להזיק לגוף אם לא נבדק באופן קבוע. מחקרים הגדירו קורטיזול כאחד הגלוקוקורטיקואידים הבולטים המופרשים עקב תגובת הביוכימיקלים של הגוף, המאופיין על ידי ציר HPA (היפותלמוס-יותרת המוח-אדרנל) מסייע לאירועים קוגניטיביים. עם זאת, כאשר רמות הקורטיזול הופכות לכרוניות בגוף עקב נסיבות שגורמות לגוף להיות לא מתפקד, זה יכול להשפיע באופן משמעותי על אדם ולגרום לחוסר איזון בציר HPA. חלק מהתסמינים שקורטיזול כרוני מוביל לגוף יכולים לכלול:

  • חוסר איזון הורמונלי
  • עמידות לאינסולין
  • עלייה במשקל
  • עלייה בשומן ה"בטן" הקרביים
  • תפוקת קורטיזול מוגברת
  • בעיות חיסוניות
    • אלרגיות ואסטמה
    • מפרקים דלקתיים
    • התאוששות לקויה מפעילות גופנית

מידע נוסף סיפק שהנוכחות של קורטיזול בגוף יכולה לעזור להגביר את זמינות הגלוקוז בדם למוח. כאשר קורטיזול מספק פונקציונליות של איברים, הגלוקוז בדם מספק אנרגיה לגוף.

 

כיצד קורטיזול וגלוקוז פועלים בגוף

קורטיזול עוזר לעורר גיוס גלוקוז המונית בכבד, ומאפשר לסינתזת חלבון לחסום לדחוף חומצות אמינו לסוכר עבור הגוף. זה ידוע בתור שחרור חומצות שומן שעבר ביולוגית טרנספורמציה לגלוקוז. כאשר זה קורה, זה עוזר לעורר אחסון שומן קרביים אם עודף גלוקוז אינו מנוצל, ובכך גורם לעלייה במשקל. מחקרי מחקר הראו שחוסר בקורטיזול עלול לגרום לירידה בייצור הגלוקוז הכבד בגוף. זה יגרום להיפוגליקמיה, שבה לגוף אין מספיק גלוקוז במערכת שלו. מחקר נוסף מראה שקורטיזול מגיב לכל גורם סטרס שמשפיע על אדם עם רמות גלוקוז נמוכות אך יכול להיות חיובי גם לאחר עומס גלוקוז. ניהול רמות הגלוקוז והקורטיזול בגוף יכול לעזור להתקדם בהתפתחות הסוכרת.


איך קורטיזול קשור לסוכרת סוג 2- וידאו

האם חווית מצבי לחץ שגורמים לשרירים שלך להימתח? מה דעתך להרגיש שרמת הסוכר שלך עולה או יורדת? האם אתה מרגיש תופעות דלקתיות בכל הגוף שגורם להם לכאוב? מתח יכול לגרום להשפעות מזיקות לגוף, להפעיל דלקת, להגביר את הטונוס הסימפטי ולהפחית את ההיענות לגלוקוקורטיקואידים. מתח יכול להיות קשור גם לסוכרת, שכן הסרטון למעלה מראה כיצד הורמון הסטרס קורטיזול קשור לסוכרת מסוג 2. מחקרים הזכירו שקורטיזול יכול להפוך לקשר שלילי למכניקה של תנגודת לאינסולין, להגביר את תפקוד תאי הבטא ולהגדיל את האינסולין המשתחרר בגוף. זה יכול להיות מסוכן עבור אנשים רבים שיש להם סוכרת קיימת והתמודדו עם מתח ללא הרף. 


הקשר השזור בין מתח וסוכרת

 

הקשר השזור בין מתח וסוכרת מוצג כ מחקרים מצאו שהפתופיזיולוגיה של חרדה וסוכרת העלתה את הסיכון לתנגודת אינסולין עבור הגוף. כאשר אדם מתמודד עם מתח כרוני, זה יכול לגרום לו לסבול מבעיות רבות כמו:

  • חוסר סובלנות קר
  • קוגניציה ומצב רוח מופחתים
  • רגישות למזון
  • אנרגיה נמוכה לאורך כל היום

כאשר זה קורה, הגוף נמצא בסיכון גבוה לפתח עמידות לאינסולין וסוכרת מסוג 2. מחקרים הזכירו שסוכרת מסוג 2 מאופיינת בתנגודת לאינסולין ובתפקוד לקוי של תאי בטא. הגלוקוקורטיקואיד בגוף יכול להיות מוגזם כדי להשפיע על התאים, ולגרום לחוסר תפקוד. מחקרים נוספים הראו שכל מתח נתפס יכול להפוך לגורם סיכון חיוני שלא רק משפיע על הגוף, כמו יתר לחץ דם, BMI (אינדקס מסת גוף), או איכות הדיאטה, אלא יכול לגרום לעלייה בסוכרת מסוג 2. כאשר אנשים מוצאים דרכים להוריד את הלחץ הכרוני שלהם, זה יכול לעזור לנהל את רמות הגלוקוז שלהם מלהגיע לרמות קריטיות.

 

סיכום

הלחץ הכרוני של הגוף עלול לגרום לתנגודת לאינסולין ולגרום לסוכרת להיות קיימת מראש. הגוף זקוק לקורטיזול וגלוקוז כדי להמשיך לתפקד ולהיות בעל אנרגיה לזוז. כאשר אנשים מתחילים לסבול ממתח כרוני ומסוכרת, זה יכול להיות מאתגר לניהול; עם זאת, ביצוע שינויים קלים בגוף כמו מציאת דרכים להורדת מתח, אכילת מזון בריא וניטור רמות הגלוקוז יכולים לעזור לגוף לאפס את רמות הגלוקוז והקורטיזול למצב נורמלי. פעולה זו יכולה להקל על אנשים רבים שרוצים להמשיך במסע הבריאות שלהם ללא מתח.

 

הפניות

אדם, Tanja C, et al. "קורטיזול קשור באופן שלילי לרגישות לאינסולין בקרב נוער לטינו עם עודף משקל." כתב העת של אנדוקרינולוגיה קלינית ומטבוליזם, The Endocrine Society, אוקטובר 2010, www.ncbi.nlm.nih.gov/pmc/articles/PMC3050109/.

De Feo, P, et al. "תרומה של קורטיזול לוויסות נגד של גלוקוז בבני אדם." כתב העת האמריקאי לפיזיולוגיה, הספרייה הלאומית לרפואה בארה"ב, יולי 1989, pubmed.ncbi.nlm.nih.gov/2665516/.

Hucklebridge, FH, et al. "תגובת הקורטיזול המתעוררת ורמות הגלוקוז בדם." מדעי חיים, הספרייה הלאומית לרפואה בארה"ב, 1999, pubmed.ncbi.nlm.nih.gov/10201642/.

יוסף, יהושע ג', ושריתה ה' גולדן. "חוסר ויסות קורטיזול: הקשר הדו-כיווני בין מתח, דיכאון וסוכרת מסוג 2." תולדות האקדמיה למדעים של ניו יורק, הספרייה הלאומית לרפואה בארה"ב, מרץ 2017, www.ncbi.nlm.nih.gov/pmc/articles/PMC5334212/.

קמבה, איה ועוד. "קשר בין רמות קורטיזול גבוהות יותר בסרום וירידה בהפרשת אינסולין באוכלוסייה כללית." פלוס אחד, ספרייה ציבורית למדע, 18 בנובמבר 2016, www.ncbi.nlm.nih.gov/pmc/articles/PMC5115704/.

Lee, Do Yup, וכו'. "היבטים טכניים וקליניים של קורטיזול כסמן ביוכימי של מתח כרוני." דוחות BMB, החברה הקוריאנית לביוכימיה וביולוגיה מולקולרית, אפריל 2015, www.ncbi.nlm.nih.gov/pmc/articles/PMC4436856/.

תאו, לורן ועוד. "פיזיולוגיה, קורטיזול." בתוך: StatPearls [אינטרנט]. אי המטמון (FL), הוצאת StatPearls, 6 בספטמבר 2021, www.ncbi.nlm.nih.gov/books/NBK538239.

כתב ויתור

ההשפעות של טיפול בלייזר נמוך על תיקון הגיד הקלקני | אל פאסו, טקסס

ההשפעות של טיפול בלייזר נמוך על תיקון הגיד הקלקני | אל פאסו, טקסס

הגוף הוא מכונה שעובדת היטב שיכולה לסבול כל דבר שנזרק בדרכה. עם זאת, כאשר הוא מקבל פציעה, תהליך הריפוי הטבעי של הגוף יבטיח שהגוף יוכל לחזור לפעילות היומיומית שלו. תהליך הריפוי של שריר פצוע משתנה בכל הגוף. תלוי עד כמה חמור הנזק וכמה זמן ייקח תהליך הריפוי, הגוף יכול להתאושש לכמה ימים עד כמה חודשים בלבד. אחד מתהליכי הריפוי האכזריים ביותר שהגוף צריך לסבול הוא קרע בגיד כף הרגל.

גיד הקלקנאל

גיד השוק או גיד אכילס הוא גיד עבה שנמצא בחלק האחורי של הרגל. גיד השריר הזה הוא מה שגורם לגוף לנוע בזמן הליכה, ריצה או אפילו קפיצה. לא רק זה, גיד השוק הוא הגיד החזק ביותר בגוף, והוא מחבר בין שרירי הגסטרוקנמיוס והסולאוס בעצם העקב. כאשר גיד השוק נקרע, תהליך הריפוי יכול להימשך בין שבועות לחודשים עד להחלמה מלאה. 

 

 

ההשפעות המרפאות של טיפול בלייזר נמוך

אחת הדרכים שיכולות לסייע לתהליך ההחלמה של גידים calcaneal פגומים היא טיפול בלייזר נמוך. מחקרים הראו שטיפול בלייזר נמוך יכול לזרז את תיקון הגיד הפגוע לאחר נגע חלקי. לא רק זה אלא המסרקטיפול באולטרסאונד וטיפול בלייזר נמוך נחקר כגורמים הפיזיים לטיפול בפציעות גידים. המחקרים הראו שלשילוב של טיפול בלייזר נמוך ואולטרסאונד יש תכונות מועילות בתהליך ההחלמה של טיפול בפציעות בגיד השוק.

 

 

המחקר מצא שכאשר חולים מטופלים בגידי השוק שלהם, רמות ההידרוקסיפרולין שלהם סביב האזור המטופל מוגברות משמעותית עם אולטרסאונד ו-t laser lowherapy. המבנים הביוכימיים והביומכניים הטבעיים של הגוף על הגיד הפגוע מתגברים, ובכך משפיעים על תהליך הריפוי. מחקר אחר הראה שטיפול בלייזר נמוך יכול לסייע בהפחתת פיברוזיס ולמנוע מתח חמצוני בגיד השוק הפגוע. המחקר אף הראה כי לאחר טראומה של גיד השוק, נוצרות באזור הפגוע דלקת, אנגיוגנזה, הרחבת כלי הדם והמטריצה ​​החוץ-תאית. אז כאשר חולים מטופלים בטיפול לייזר נמוך במשך כארבעה עשר עד עשרים ואחד ימים, החריגות ההיסטולוגיות שלהם מוקלות, ומפחיתות את ריכוז הקולגן והפיברוזיס; מניעת התגברות מתח חמצוני בגוף.

 

סיכום

בסך הכל, נאמר שההשפעות של טיפול בלייזר נמוך יכולות לעזור להאיץ את תהליך הריפוי של תיקון גיד השוק. התוצאות המבטיחות הוכחו מאחר שטיפול בלייזר נמוך יכול לסייע בתיקון הגיד הפגוע, הפחתת מתח חמצוני ומניעת הסלמה של פיברוזיס, וגורם לבעיות נוספות בגיד הפגוע. ועם השילוב של אולטרסאונד, גיד השוק יכול להתאושש מהר יותר כך שהגוף יוכל להמשיך בפעילות היומיומית שלו ללא פציעות ממושכות.

 

הפניות:

דמיר, חוסיין ועוד. "השוואה של ההשפעות של טיפולי לייזר, אולטרסאונד וטיפולי לייזר + אולטרסאונד משולבים בריפוי גידים ניסיוני." לייזרים בכירורגיה ורפואה, הספרייה הלאומית לרפואה בארה"ב, 2004, pubmed.ncbi.nlm.nih.gov/15278933/.

פיליפין, לידיאן איזבל, et al. "טיפול בלייזר ברמה נמוכה (LLLT) מונע מתח חמצוני ומפחית פיברוזיס בגיד אכילס שעבר טראומה של חולדה." לייזרים בכירורגיה ורפואה, הספרייה הלאומית לרפואה בארה"ב, אוקטובר 2005, pubmed.ncbi.nlm.nih.gov/16196040/.

אוליביירה, פלאביה שליטלר ועוד. השפעת טיפול בלייזר ברמה נמוכה (830 ננומטר ... – לייזר רפואי. 2009, medical.summuslaser.com/data/files/86/1585171501_uLg8u2FrJP7ZHcA.pdf.

Wood, Viviane T, et al. "שינויים ויישור קולגן הנגרמים על ידי טיפול בלייזר ברמה נמוכה ואולטרסאונד בעצימות נמוכה בגיד הקלקנל." לייזרים בכירורגיה ורפואה, הספרייה הלאומית לרפואה בארה"ב, 2010, pubmed.ncbi.nlm.nih.gov/20662033/.

אנדוקרינולוגיה פונקציונאלית: קצב קרדיסל ומלטונין

אנדוקרינולוגיה פונקציונאלית: קצב קרדיסל ומלטונין

אתה מרגיש:

  • אתה לא יכול להירדם בלילה?
  • יש לך התחלה איטית בבוקר?
  • עייפות אחר הצהריים?
  • מתעוררת עייפה גם לאחר קבלת שש שעות ויותר שינה?
  • תחת כמות מתח גבוהה?

אם אתה נתקל באחד מהמצבים הללו, ייתכן שזה נובע מרמות המלטונין והקורטיזול שלך שמשפיעים על גופך ועל קצב הצירוף.

ברחבי העולם מיליוני אנשים מתקשים לישון. בארצות הברית יש בערך 50-70 מיליון אנשים שיש להם איכות שינה ירודה. כאשר אדם ישן פחות משמונה שעות הם מתעייפים ובעיות רבות יכולות להגיע אליהם, במיוחד אם חייו קדחתניים. עם אורח חיים קדחתני ושינה ירודה, זה יכול לגרום לגוף להיות בעל אנרגיה נמוכה לבצע כל משימה, הורמון הלחץ של קורטיזול יעלה, ומחלות כמו לחץ דם גבוה וסוכרת יכולות לגרום לבעיות שיכולות להיות כרוניות אם זה לא טופל.

BBP7B6x

באנדוקרינולוגיה תפקודית, מלטונין וקורטיזול הם הורמונים שהגוף מייצר באופן טבעי. הורמון הקורטיזול או הורמון הלחץ עוזרים לגוף להיות במצב "קרב או טיסה", דבר שיכול להיות דבר טוב עבור כל מי שעושה פרויקט או הולך לראיון עבודה. למרות שכאשר רמות הורמון הקורטיזול גבוהות, זה יכול לגרום לגוף לסיבוכים כמו דלקת, לחץ חמצוני כרוני ולחץ דם גבוה.

הקצב הצירקדי של המלטונין

עם הורמון המלטונין הורמון זה אומר לגוף מתי הגיע הזמן לישון. אך לעיתים, אנשים מתקשים לישון, ונטילת תוספי מלטונין יכולה להרגיע את הגוף ובכך לגרום לאדם להירדם. מכיוון שבלוטת האצטרובל מייצרת מלטונין מהמוח, ניתן למצוא אותו גם בעיניים, במח העצם ובמעי כדי להרפות את הגוף ולהביא לאדם להירדם באופן טבעי. כמה מחקרים מראים כי הקצב הצירקדי של בלוטת האצטרובל המייצר מלטונין. בכך, המחקר מראה כי מתן מלטונין יכול:

  • אחתלגרום לישון אצל אנשים שמתקשים להירדם.
  • שני: מעכב את הגוף להתעורר באופן טבעי מהקוצב הלב הצבדי.
  • שלוש: העבירו את השעונים הביולוגיים הצמודים כדי להגדיל את צריכת השינה כאשר אדם מנסה לישון בזמן מוקדם יותר כדי להשיג את מלוא היתרונות של שמונה שעות שינה.

כאשר אדם עובד במשרה 9 עד 5, הוא קם עם גופם ומרגיע את גופם לאחר יום קשה בעבודה. מחקרים גילו שהורמוני המלטונין והקורטיזול עוזרים לווסת את התבנית 24 שעות ביממה של תפקוד הגוף ותגובותיו בצורה אדירה. עם מחזור ייצור ההורמונים של הגוף, זה יכול להיות מופרע אם האדם נשאר ער מאוחר בלילה או ישן במהלך היום. כאשר זה קורה, האדם יכול לקבל הפרעות משבשות כמו שינויי מצב רוח, סחרחורת, להיות עצבני ודיכאון, וסובל מהפרעות מטבוליות. לא זו בלבד, אלא שגם מערכת החיסון של הגוף ומערכת האנדוקרינית שלו עלולה להיפגע, וגם לגרום לגוף להיות מארח בזיהומים ומחלות.

היו יותר מחקרים על המקצבים הצירקדים בגוף, כמו המחקרים מראים כיצד אנשים שעובדים במשמרת הלילה נקשרו למספר עצום של בעיות בריאותיות שליליות התוקפות את מערכת הלב וכלי הדם ומערכת העיכול וכן מפריעות למערכת המטבולית. כל מי שעבד במשמרת הלילה צריך לשנות את לוח השינה שלו ולהתאים את עצמו לכיוון המחודש המהיר בלוח השינה / השכמה שלהם כדי לעבוד לעבודה ולבצע את עבודתו. מכיוון שכולם עובדים בלוח זמנים של משמרת, זה יכול להיות מלחיץ ויכול להשפיע על ביצועי גופו של העובד כמו גם על השפעה על הפרשת המלטונין וקורטיזול.

דרכים לתמיכה בקורטיזול ומלטונין

אולם באופן מפתיע, ישנן דרכים להוריד את רמות הקורטיזול ולוודא שרמות המלטונין פועלות כראוי כדי שהגוף יתפקד. כדי להוריד את רמות הקורטיזול, אדם צריך לעשות תרגולים מדיטטיביים, למצוא תחביב מהנה, והכי חשוב לנסות תרגילי נשימה עמוקים כדי להרפות את הגוף ממתח לא רצוי. בעזרת תרגילי נשימה עמוקים זה יכול לעזור לגוף לשחרר כל מתח שאדם אוחז בו, והשרירים בגוף החלו להירגע, והדם מתחיל לזרום. ברמות המלטונין הם עובדים יחד עם הקצב הצירופי של הגוף ומוודאים שהגוף יודע מתי הגיע הזמן להתעורר, לישון ולאכול. הורמון המלטונין יכול גם לסייע בוויסות טמפרטורת הגוף, לחץ דם, ורמות הורמונים כדי לוודא שהוא פועל כראוי. כשיש רמות גבוהות של מערכות אלה, זה יכול לגרום לגוף להתפתח מחלות כרוניות ולפגוע בגוף בתהליך.

מחקרים מראים שהורמוני מלטונין יכולים להיקשר לקולטנים נוירולוגיים בגוף, ובכך לקדם רגיעה. מכיוון שמלטונין נקשר לקולטנים נוירולוגיים, הוא יכול גם להפחית את פעילות העצבים ואת רמות הדופמין בכדי להפוך את העיניים לכבדות, ובכך לגרום לאדם להירדם.

סיכום

כשהגוף מסוגל לייצר באופן טבעי רמות מלטונין וקורטיזול כדי לוודא שהגוף לא נלחץ יתר על המידה לאורך כל היום. מכיוון שמלטונין משולב בקצב העגול של הגוף, הגוף יודע מתי להישאר ער ולהירדם. מכיוון שלכולם יש לוח זמנים קדחתני, חיוני לקחת זמן ולהירגע ולהגיע ללוח שינה בריא כדי שהגוף יוכל להיות בריא ומתפקד. כמה מוצרים נמצאים כאן כדי לוודא שהמערכת האנדוקרינית מתפקדת כראוי ותומכת בבלוטת יותרת הכליה וחילוף החומרים הסוכר.

היקף המידע שלנו מוגבל לנושאי בריאות כירופרקטיקה, שרירים ושלד ועצב או מאמרים, נושאים ודיונים ברפואה תפקודית. אנו משתמשים בפרוטוקולים בריאותיים תפקודיים לטיפול בפגיעות או בהפרעות במערכת השלד והשרירים. משרדנו עשה ניסיון סביר לספק ציטוטים תומכים ואיתר את המחקר או המחקרים הרלוונטיים התומכים בתפקידים שלנו. אנו גם מעמידים עותקים של מחקרי מחקר תומכים לרשות הלוח או לציבור על פי דרישה. לדיון נוסף בנושא לעיל, אנא אל תהסס לשאול את ד"ר אלכס חימנז או צור איתנו קשר בכתובת 915-850-0900.


הפניות:

Cajochen, C, et al. תפקיד המלטונין בהסדרת מקצבים ושינויים אנושיים אנושיים Journal of Neuroendocrinologyהספרייה הלאומית לרפואה בארה"ב, אפריל 2003, www.ncbi.nlm.nih.gov/pubmed/12622846.

ג'יימס, פרנסין או, ואח '. מקצבים צירקפיים של מלטונין, קורטיזול וביטוי גן שעון במהלך עבודת משמרת לילה מדומה. שינה, Associated Sleep Sleep Sociations, LLC, נובמבר 2007, www.ncbi.nlm.nih.gov/pmc/articles/PMC2082093/.

מונטליאון, P, et al. הקשר הזמני בין מלטונין לתגובות קורטיזול למתח פיזי בלילה בבני אדם. פסיכו-אננדוקרינולוגיההספרייה הלאומית לרפואה בארה"ב, 1992, www.ncbi.nlm.nih.gov/pubmed/1609019.

ראמאן, ראיין. איך מלטונין יכול לעזור לך לישון ולהרגיש טוב יותר Healthline, Healthline Media, 3 ספטמבר 2017, www.healthline.com/nutrition/melatonin-and-sleep.

זמאניאן, זהרה ואח '. מתווה שינויים בקצב הקורטיזול והמלטונין במאבטחי אוניברסיטת שיראז למדעי הרפואה. כתב העת הבינלאומי לרפואה מונעת, Medknow Publications & Media Pvt Ltd, יולי 2013, www.ncbi.nlm.nih.gov/pmc/articles/PMC3775223/.


רפואה אינטגרטיבית ותפקודית מודרנית- אסה קוואם ווידריי

על ידי יידוע אנשים על האופן בו האוניברסיטה הלאומית למדעי הבריאות מספקת ידע לדורות הבאים שרוצים לעשות שינוי בעולם. האוניברסיטה מציעה מגוון רחב של מקצועות רפואיים לרפואה תפקודית ואינטגרטיבית.

5 דרכים שאתה פוגע במעיים שלך אל פאסו, טקסס

5 דרכים שאתה פוגע במעיים שלך אל פאסו, טקסס

שאלתם את עצמכם מדוע אתם מרגישים איטים מיום ארוך? או להרגיש חולה בבטן כשאכלת משהו לא טוב או התמוגגת יתר על המידה מהאוכל האהוב עליך? יכול להיות שהמעיים שלך מראים סימני לחץ ואי נוחות בגלל הרגלים מסוימים שאתה עלול להיתקל בהם ואפילו לא ידעת על כך?

במאמר הקודם שלנו דיברנו ששת סוגי המזון שהמעיים שלנו צריכים להיות בריאים. מאז הבטן שלנו מכיל טריליוני מיקרוביומות, טובים ורעים כאחד, מיקרוביומות אלה ממלאים תפקיד חשוב בבריאותנו הכללית. מיקרוביומה בריאה משפרת את שלנו בריאות מעיים, בריאות לב, בריאות המוח, שולט במשקל שלנו ו מווסת את רמת הסוכר בדם שלנו. עם החיידקים הטובים במעי שלנו, החיידקים מועילים לנו עם מערכת עיכול טובה ומשמיד את החיידקים המזיקים. אולם אורח חיים מסוים ובחירות דיאטטיות יכולות למעשה להגדיל את החיידקים הרעים ולהוריד את החיידקים הטובים ואת הבריאות הכללית.

 

 

11860 Vista Del Sol, Ste. 128 5 דרכים שבהן אתה פוגע בבטן אל פאסו, טקסס

 

להלן חמש אפשרויות בחירה מפתיעה באורח החיים הפוגעות במעי שלך:

לא אוכלים מגוון רחב של אוכלים

למעי שלנו תפקיד חשוב בבריאות הכללית שלנו. כאשר אנו אוכלים אוכלים שלמים טובים, הבטן שלנו מאושרת יותר; יש לנו יותר אנרגיה להשלים כל משימה שנזרקת עלינו ואנחנו מקבלים חומרים מזינים לצמחיית הבטן שלנו. עם זאת, במהלך העשורים האחרונים אנו נוטים יותר למזון מעובד בגלל הלחץ הכלכלי של הפקות מזון מוגברות. FOA קבע כי 75 אחוז מהאוכל העולמי נוצר מ 12 צמחים בלבד וחמישה מיני בעלי חיים וזה רע מאוד לצמחיית המעיים שלנו.

כאן במרפאת Injury Medical & Chiropractic אנו מודיעים למטופלים שלנו על החשיבות של אכילת מזונות מלאים ומזינים כדי לקדם לא רק מעי בריא אלא נפש בריאה. כשהגוף מתוודע לא מגוון רחב של מזונות שלמים (עם כמות גבוהה של סיבים תזונתיים), המעי שלנו מתחיל לתקן את הנזק של מזון מעובד שאנו צרכנו באופן פנימי.

 

11860 Vista Del Sol, Ste. 128 5 דרכים שבהן אתה פוגע בבטן אל פאסו, טקסס

צריכה פרביוטית לא מספקת

Prebiotics הם הסיבים שלא צריך לעכל ויכולים לעבור דרך המעיים שלנו. זה אולי נראה כמו בזבוז, פרוביוטיקה מעודד חיידקים ידידותיים לצמוח במעי שלנו. כל פירות עשירים בסיבים תזונתיים כמו תפוחים יכולים למעשה לעזור להועיל חיידקים כמו ביפידובקטריה.

עם זאת, כשאתה מתעלם מפרה-ביוטיקה מהתזונה שלך, אתה כן פגיעה בבריאות העיכול שלך. ללא פרביוטיקה, מערכת העיכול שלנו מאטה את ההתפתחות והמגוון של פלורת המעיים שלנו. אז כדי שיהיה א מיקרוביומה בריאה בפיתוח, עליכם לשלב תזונה במזון מלא בסיבים מעכלים ובעיכול קל לעיכול. חלק מהמאכלים הנכללים בקטגוריה זו הם שיבולת שועל, אגוזים, בצל, שום, כרישה, אספרגוס, בננות, אגסים, חומוס ושעועית.

אם נדבקים בדיאטה עשירה בסיבים תזונתיים אולי מאתגרים עם זאת, קיימת האפשרות ליטול תוספי תזונה פרביוטיים. אם יש לך אלרגן למזון או רגישות למזון לכל מזון עשיר בסיבים עשירים, קח תוספי חלבון פרביוטיים למעשה יכול לעזור לגדל Bifidobacterium ו- Faecalibacterium במעי שלך ולהועיל לבריאות שלך ללא אי הנוחות.

 

צריכת אלכוהול מופרזת

כל מבוגר נהנה מאלכוהול מדי פעם. כן, זה אחד מאותם משקאות שעוזרים לך להירגע קצת אחרי יום ארוך, אולם יותר מדי מזה עלול להוביל להתעללות באלכוהול ולהתמכרות. אז האם ידעתם שצריכת כל כך הרבה אלכוהול היא רע בשביל הלב, הכבד והמוח שלך; ובכך לפגוע בבריאות המעי שלך ולתת לך dysbiosis?

מחקר אחד קבע, כי לאלכוהוליסטים עם דיסביוזה היה שפע חציוני נמוך יותר של Bacteroidetes ושפע גבוה של Proteobacteria. אלה שלא היו אלכוהוליסטים לא הושפעו מהמחקר.

למרות זאת; יש חדשות טובות על הגבלת עצמך לאלכוהוליזם וזה יכול להועיל לחיידקי הבטן שלך. אם אכלתם בינוני יין אדום באופן אחראי, פוליפנולים ביין יכול לעזור להועיל לצמחיית הבטן שלך. אז, תיהנו מכוס יין מדי פעם כפינוק קטן שאסור לקחת כמובן מאליו.

שינה לא מספקת

באחד המאמרים הקודמים דיברנו על איך להשיג א שינה טובה בלילה דרך עשבי תיבול. כשאנחנו לא מצליחים לישון מעט במהלך חיינו הקדחתניים, זה משפיע עלינו דרך בעיות בריאות שונות, כולל מחלת לב ו השמנה. ב מחקר 2016החוקרים גילו את ההשפעה של חסך שינה לטווח קצר על מיקרוביוטה של ​​המעי לאחר יומיים.

כאשר גופנו אינו מקבל את 8 שעות השינה המומלצות, המעיים גובים מחיר עצום מכיוון שאנו מרגישים איטים ותשושים. אז, כדי לוודא כי שלנו מיקרוביומה במעיים יטופל, המלצנו לכבות את המכשירים האלקטרוניים שלך לפחות 30 דקות לפני שתתכונן להתיישב למשך הלילה. כבה את כל האורות ואל תשתה נוזלים לפחות שעתיים לפני השינה, עצמך עיניים וקח נשימה עמוקה במצב מדיטטיבי, והירגע כשאתה נסחף לעיירת שינה.

 

 

פעילות גופנית לא מספקת

דרך אורח החיים המהיר והעבודות הלחוצות שלנו, קשה למצוא זמן להתאמן. אבל כשאנחנו באמת מוצאים זמן להתאמן, לא רק שהמוח שלנו מרגיש טוב; אבל גם הגוף והמעיים שלנו מרגישים טוב. עם זאת, דברים תמיד עולים כשאנחנו בשגרת פעילות גופנית ועלינו לדלג על פעילות גופנית לגמרי. זה קורה לכולנו וקשה להפסיק לאן שהפסקנו כשניסינו להתאמן.

כשאנחנו לא מתאמנים לפחות כמה פעמים במהלך השבוע, גופנו גובה מאיתנו מחיר עצום כאשר עלינו במשקל, הלחץ הוא גבוה מדיויש לנו א סיכוי גבוה יותר לחלות במחלה כרונית. כשזה קורה צמחיית הבטן שלנו היא חסרון עצום. כאן בקליניקה אנו שואפים ליידע את מטופלינו על חשיבות האימון וכי זה לא רק משנה את חייהם אלא גם משנה את מצב הרוח שלהם לחלוטין.

עם זאת, אל תיכנס לשגרת אימונים קשה שבה תפצע את עצמך. התחל באימון בעצימות נמוכה ואז בנה אותו תוך כדי, כי פלורת המעיים שלך תודה לך על כך.

כמאמר אחרון, אנו כאן ב Injury Medical רוצים להתעדכן בנוגע לתזונה ודרכים שיעזרו לכם לשפר את מחלותיכם בהפתעות ה- 5 הללו. אבל גם לחנך אותך מה עלול לפגוע במעי שלך. עם הפתעות אלה ושינויים קלים בחיי היומיום שלך, הבטן שלך תודה לך על המסע הארוך.

 


 

משאבים NCBI

על פי עדויות ממחקר של 2016, מערכת החיסון של המעיים היא מהותית למניעת מגוון מחלות והיא עשויה לעתים קרובות לתרום להפרעות מטבוליות. עם זאת, זה עשוי גם לעזור לספק מטרה טיפולית בעת התבוננות בדלקת מערכתית בעמידות לאינסולין. יתר על כן, חסינות מעיים שונה נקשרה לשינויים במיקרוביוטה במעיים, בתפקוד מחסום המעי, בתאי מערכת החיסון המעיים ובעמידות לאנטיגנים הנכנסים למערכת העיכול או מערכת העיכול. למרות שהאמינו בעבר כי הדבר מעלה את הסכנה למחלות הוושט, כולל זיהומים פתוגניים ודלקת כרונית, העלולים בסופו של דבר להוביל לבעיות בריאות כרוניות.

 

 

תפקידים רב-ממדיים של גופי קטון

תפקידים רב-ממדיים של גופי קטון

גופי קטון נוצרים על ידי הכבד ומשמשים כמקור אנרגיה כאשר גלוקוז אינו זמין בגוף האדם. שני גופי הקטון העיקריים הם אצטואצטט (AcAc) ו- 3-beta-hydroxybutyrate (3HB), ואילו אצטון הוא גוף הקטון השלישי והנפוץ ביותר. קטונים קיימים תמיד בדם ורמותיהם עולות במהלך צום ופעילות גופנית ממושכתKetogenesis הוא תהליך ביוכימי שבו אורגניזמים מייצרים גופי קטון דרך התמוטטות של חומצות שומן וחומצות אמינו קטוגניות.

גופי Ketone נוצרים בעיקר ב המיטוכונדריה של תאי הכבד. Ketogenesis מתרחשת כאשר יש רמות גלוקוז נמוכות בדם, במיוחד לאחר חנויות פחמימות סלולריות אחרות, כגון גליקוגן, כבר מותש. מנגנון זה יכול להתרחש גם כאשר יש כמות מספקת של אינסולין. הייצור של גופי ketone הוא יזמה בסופו של דבר כדי להפוך אנרגיה זמינה אשר מאוחסן בגוף האדם כמו חומצות שומן. Ketogenesis מתרחשת במיטוכונדריה שבה הוא מוסדר באופן עצמאי.

תַקצִיר

קטון הגוף מטבוליזם הוא הצומת המרכזי בהומיאוסטזיס פיזיולוגי. בסקירה זו, אנו דנים כיצד קטונים משרתים תפקידים מטבוליים מובחנים של כוונון עדין, אשר מייעלים את הביצועים של איברים ואורגניזמים בשרידי מזון שונים ומגינים מפני דלקת ופציעה במערכות איברים מרובות. באופן מסורתי נתפס מצעים מטבוליים התגייס רק להגבלת הפחמימות, תצפיות האחרונות מדגישות את החשיבות של גופים קטון כמו מטבולי חיוני מתווכים איתות כאשר הפחמימות הן בשפע. משלימים רפרטואר של אפשרויות טיפוליות ידועים עבור מחלות של מערכת העצבים, תפקידים פוטנציאליים עבור גופי ketone בסרטן נוצרו, כמו גם תפקידים מגן מסקרן בלב וכבד, פתיחת אפשרויות טיפוליות הקשורות בהשמנת יתר ומחלות לב וכלי דם. מחלוקות של מטבוליזם קטון אותות נדונים כדי ליישב דוגמה קלאסית עם תצפיות עכשוויות.

מבוא

גופי קטון הם מקור דלק מטבולי אלטרנטיבי חיוני לכל תחומי החיים, האאוקריה, החיידקים והארכאים (Aneja et al., 2002; Cahill GF Jr, 2006; Krishnakumar et al., 2008). חילוף החומרים בגוף הקטון בבני אדם ממונף על מנת לתדלק את המוח בתקופות אפיזודיות של מחסור בחומרים מזינים. גופי קטון שזורים במסלולים מטבוליים מכריעים של יונקים כמו? -חמצון (FAO), מחזור החומצה הטריקרבוקסילית (TCA), גלוקונאוגנזה, ליפוגנזה דה נובו (DNL) וביוסינתזה של סטרולים. אצל יונקים, גופי קטון מיוצרים בעיקר בכבד מאצטיל-CoA שמקורם ב- FAO, והם מועברים לרקמות חוץ-כבדות לצורך חמצון סופני. פיזיולוגיה זו מספקת דלק חלופי המוגבר על ידי תקופות צום קצרות יחסית, מה שמגדיל את זמינות חומצות השומן ומפחית את זמינות הפחמימות (Cahill GF Jr, 2006; McGarry and Foster, 1980; Robinson and Williamson, 1980). חמצון גוף קטון הופך לתורם משמעותי לחילוף החומרים הכללי של יונקים בתוך רקמות חוץ-כבדות במספר עצום של מצבים פיזיולוגיים, כולל צום, רעב, תקופת הילודים, לאחר האימון, הריון, והקפדה על דיאטות דלות בפחמימות. מחזור הריכוז הכולל של קטון בגוף בבני אדם מבוגרים בריאים מציג בדרך כלל תנודות ביממה בין 100-250 מ"מ, עולה ל ~ 1 מ"מ לאחר פעילות גופנית ממושכת או 24 שעות בצום, ויכול להצטבר עד 20 מ"מ במצבים פתולוגיים כמו קטואצידוזיס סוכרתית ( Cahill GF Jr, 2006; Johnson et al., 1969b; Koeslag et al., 1980; Robinson and Williamson, 1980; Wildenhoff et al., 1974). הכבד האנושי מייצר עד 300 גרם של גופי קטון ביום (Balasse and Fery, 1989), שתורמים בין 5% מכלל ההוצאה האנרגטית במדינות מוזנות, בצום ומורעב (Balasse et al., 20; Cox et. al., 1978).

מחקרים אחרונים מדגישים כעת תפקידים הכרחיים עבור גופי קטון בחילוף החומרים בתאי יונקים, הומיאוסטזיס, ומסמנים תחת מגוון רחב של מצבים פיזיולוגיים ופתולוגיים. מלבד השימוש בדלקי אנרגיה לרקמות חוץ-כמויות, כגון שרירי מוח, לב או שרירי השלד, גופי קטון ממלאים תפקידים מרכזיים כמגשרים איתותים, נהגים של שינוי חלבונים לאחר טרנסלוציאציה (PTM), ומודולים של דלקת או מתח חמצוני. בסקירה זו, אנו מספקים הן קלאסית ומודרנית תצוגות של תפקידים pleiotropic של גופי קטון ואת חילוף החומרים שלהם.

סקירה כללית של מטבוליזם הגוף קטון

קצב הקטוגנזה בכבד נשלט על ידי סדרה מתוזמרת של שינויים פיזיולוגיים וביוכימיים של שומן. הרגולטורים העיקריים כוללים ליפוליזה של חומצות שומן מטריאצילגליצרולים, הובלה אל עבר קרום הפלזמה של הפטוציטים, הובלה למיטוכונדריה דרך קרניטין פלמיטוילטרנספרז 1 (CPT1), ספירלת חמצון?, פעילות מחזור TCA וריכוזים בינוניים, פוטנציאל חידוש, והווסתים ההורמונליים. מתהליכים אלה, בעיקר גלוקגון ואינסולין [נבדקו ב- (Arias et al., 1995; Ayte et al., 1993; Ehara et al., 2015; Ferre et al., 1983; Kahn et al., 2005; McGarry and Foster) , 1980; וויליאמסון ואח ', 1969)]. קטוגנזה קלאסית נתפסת כנתיב זליגה, שבו אצטיל-CoA הנגזר מ- חמצון עולה על פעילות הסינתזה של ציטראט ו / או זמינות של אוקסאלו-אצטט להתעבות ליצירת ציטראט. תוצרי ביניים של שלושה פחמנים מציגים פעילות אנטי-קטוגנית, ככל הנראה בשל יכולתם להרחיב את מאגר האוקסלו-אצטט לצריכת אצטיל-CoA, אך ריכוז אצטיל-CoA בכבד בלבד אינו קובע את קצב הקטוגני (פוסטר, 1967; Rawat ו- Menahan, 1975; Williamson ואח ', 1969). ויסות הקטוגנזה על ידי אירועים הורמונליים, תעתיקיים ואחרי תרגום תומכים יחד ברעיון שהמנגנונים המולקולריים שמכוונים קצב קטוגני עדין נותרים מובנים לחלוטין (ראה תקנה של HMGCS2 ו- SCOT / OXCT1).

קטוגנזה מתרחשת בעיקר במטריצה ​​המיטוכונדריה בכבד בשיעורים פרופורציונליים לחמצון השומן הכולל. לאחר הובלה של שרשראות אצטיל על פני הממברנות המיטוכונדריה ו-חמצון, האיזופורם המיטוכונדריאלי של סינתזה 3-הידרוקסימאתיל גלוטריאל-קו-א (HMGCS2) מזרז את הגורל לביצוע עיבוי של אצטו-אצטיל-קו-א (AcAc-CoA) ואצטיל-קו א ליצירת HMG-CoA (איור 1 א). HMG-CoA lyase (HMGCL) חותך את HMG-CoA לשחרור אצטיל-CoA ו- acetoacetate (AcAc), והאחרון מצטמצם ל- d -? - hydroxybutyrate (d-? OHB) על ידי פוספטידילכולין תלוי פוספטידילכולין d-? OHB dehydrogenase ( BDH1) בתגובה קרובה לשיווי משקל בשילוב NAD + / NADH (Bock and Fleischer, 1975; LEHNINGER et al., 1960). קבוע שיווי המשקל BDH1 מעדיף ייצור d-? OHB, אך היחס בין גופי קטון AcAc / d-? OHB פרופורציונלי ישיר ליחס NAD + / NADH המיטוכונדריאלי, וכך פעילות BDH1 oxidoreductase ממודדת את פוטנציאל החמצון המיטוכונדריאלי (Krebs et al., 1969; ויליאמסון ואח ', 1967). AcAc יכול גם לדקרבוקסילט באופן ספונטני לאצטון (Pedersen, 1929), מקור הריח המתוק בבני אדם הסובלים מקטואצידוזיס (כלומר, סך כל גופי הקטונים בסרום> ~ 7 מ"מ; AcAc pKa 3.6,? OHB pKa 4.7). המנגנונים שבאמצעותם מועברים גופי קטון על פני הממברנה הפנימית המיטוכונדריאלית אינם ידועים, אך AcAc / d-? OHB משתחררים מתאים באמצעות מעבירים מונו-קרבוקסילטים (אצל יונקים, MCT 1 ו- 2, הידועים גם כמובילים מומסים 16A בני משפחה 1 ו 7) ומועבר במחזור לרקמות חוץ-כבדות לחמצון סופני (Cotter et al., 2011; Halestrap and Wilson, 2012; Halestrap, 2012; Hugo et al., 2012). ריכוזי גופי הקטון במחזור גבוהים יותר מאלו ברקמות החוץ-כבדות (הריסון ולונג, 1940) המצביעים על גופי קטון מועברים במדרון ריכוז. מוטציות של אובדן תפקוד ב- MCT1 קשורות להתקפים ספונטניים של קטואצידוזיס, דבר המצביע על תפקיד קריטי בייבוא ​​גוף הקטון.

למעט פיזור פוטנציאלי של גופי קטון לגורלות שאינן מחמצנות (ראה גורלות מטבוליים שאינם מחמצנים של גופי קטון), לפטוציטים אין יכולת לחילוף חומרי גופי הקטון שהם מייצרים. גופי קטון המסונתזים דה נובו על ידי כבד הם (i) מצטברים במיטוכונדריה של רקמות חוץ-כבדות לאצטיל-CoA, הזמינים למחזור TCA לחמצון סופני (איור 1 א), (ii) מופנים למסלולי הליפוגנזה או סינתזת הסטרול ( איור 1B), או (iii) מופרש בשתן. כדלק אנרגטי חלופי, גופי הקטון מתחמצנים בלב, בשרירי השלד ובמוח (Balasse and Fery, 1989; Bentourkia et al., 2009; Owen et al., 1967; Reichard et al., 1974; Sultan, 1988 ). BDH1 מיטוכונדריאלי חוץ-כבד מזרז את התגובה הראשונה של חמצון? OHB, וממיר אותו לגב AcAc (LEHNINGER et al., 1960; Sandermann et al., 1986). ל- d-? OHB-dehydrogenase (BDH2) ציטופלזמי עם זהות רצף של 20% בלבד ל- BDH1 יש Km גבוה לגופי קטון, והוא גם ממלא תפקיד בהומאוסטזיס ברזל (Davuluri et al., 2016; Guo et al., 2006). . במטריקס מיטוכונדריאלי חוץ-כבד, AcAc מופעל ל- AcAc-CoA באמצעות חילוף של CoA- מחלקה מ- succinyl-CoA בתגובה מזרזת על ידי טרנספרז CoA יונקי ייחודי, succinyl-CoA: טרנספרז 3-oxoacid-CoA (SCOT, CoA transferase; מקודד על ידי OXCT1), דרך תגובת שיווי משקל כמעט. האנרגיה החופשית המשתחררת על ידי הידרוליזה של AcAc-CoA גדולה מזו של succinyl-CoA, ומעדיפה היווצרות AcAc. לפיכך שטף חמצון בגוף הקטון מתרחש עקב פעולה המונית: אספקה ​​בשפע של AcAc וצריכה מהירה של אצטיל-CoA באמצעות סינתז ציטראט מעדיפה היווצרות AcAc-CoA (+ succinate) על ידי SCOT. יש לציין שבניגוד לגלוקוז (hexokinase) וחומצות שומן (acyl-CoA synthetases), הפעלת גופי קטון (SCOT) לצורה מחמצנת אינה דורשת השקעה של ATP. תגובה הפיכה של AcAc-CoA תיאולאז [מזרזת על ידי אחד מארבעת התיולזות המיטוכונדריאליות המקודדות על ידי ACAA2 (המקודד לאנזים המכונה T1 או CT), ACAT1 (המקודד T2), HADHA או HADHB] מניבה שתי מולקולות של אצטיל-CoA, שנכנסים למחזור ה- TCA (הרש וג'נקקס, 1967; שטרן ואח ', 1956; וויליאמסון ואח', 1971). במצבים קטוטיים (כלומר, סך כל הקטונים בסרום> 500M) גופי הקטון הופכים לתורמים משמעותיים להוצאות האנרגיה ומנוצלים ברקמות במהירות עד שמתרחשת ספיגה או רוויה של חמצון (Balasse et al., 1978; Balasse and Fery, 1989 ; אדמונד ואח ', 1987). ניתן למדוד בקלות חלק קטן מאוד מגופי הקטון שמקורם בכבד בשתן, ושיעורי השימוש והספיגה מחדש של הכליה הם פרופורציוניים לריכוז במחזור (גולדשטיין, 1987; רובינסון וויליאמסון, 1980). במצבים קטוטיים מאוד (> 1 מ"מ בפלזמה), קטונוריה משמשת ככתב כמותי למחצה של קטוזיס, למרות שרוב המבחנים הקליניים של גופי קטון בשתן מזהים AcAc אך לא? OHB (Klocker et al., 2013).

קטוגני מצעים והשפעתם על מטבוליזם hepatocyte

מצעים קטוגניים כוללים חומצות שומן וחומצות אמינו (איור 1B). קטבוליזם של חומצות אמינו, במיוחד לאוצין, מייצר על 4% של גופים קטון במצב שלאחר ספיגה (תומס ואח ', 1982). לפיכך, מאגר המצע של אצטיל-קוה לייצור גופי קטון נובע בעיקר מחומצות שומן, שכן במצבים של אספקת פחמימות פוחתת, pyruvate נכנס למחזור ה- TCA הכבד בעיקר באמצעות anaplerosis, כלומר, carboxylation תלויי ATP ל- oxaloacetate (OAA) (MAL), ולא דקרבווקסילציה חמצונית לאצטיל-קוא (ג 'ונג ואח', 2012, מגנוסון ואח ', 1991, מריט ואח', 2011). בכבד, גלוקוז ופירובט תורמים באופן מזערי לקטוגנזה, גם כאשר דקרבווקסילציה של pyruvate ל- acetyl-CoA היא מקסימלית (Jeoung et al., 2012).

Acetyl-CoA משתרע מספר תפקידים אינטגרלי לחילוף החומרים של הכבד מעבר לייצור ATP באמצעות חמצון סופני (ראה גם שילוב של מטבוליזם של גוף קטון, שינוי לאחר טרנסלוציאציה ופיזיולוגיה של התא). Acetyl-CoA מפעיל באופן אקוסטי (i) pyruvate carboxylase (PC), ובכך מפעיל מנגנון בקרה מטבולית המגדיל את כניסתם של מטבוליטים לתוך מחזור ה- TCA (Owen et al, 2002, Scrutton and Utter, 1967) ו- (ii) pyruvate dehydrogenase קינאז, אשר phosphorylates ומעכב deydrogenase pyruvate (PDH) (קופר ואח ', 1975), ובכך לשפר עוד יותר את זרימת pyruvate לתוך מחזור TCA באמצעות anaplerosis. יתר על כן, cytoplasmic acetyl-CoA, אשר הבריכה שלה הוא augmented על ידי מנגנונים כי להמיר אצטיל methochondrial-CoA כדי מטבוליטים ניידים, מעכב חומצת שומן חומצה: אצטיל- COA carboxylase (ACC) מזרז את ההמרה של אצטיל- CoA כדי malonyl-CoA, המצע ליפוגנית ו מעכב allosteric של מיטוכונדריה CPT1 [נסקרו ב (Kahn et al., 2005; McGarry ו פוסטר, 1980)]. לכן, המיטוכונדריאלי אצטיל- CoA הבריכה שניהם מסדיר והוא מוסדר על ידי נתיב הגלישה של קטוגנזה, אשר תזמור היבטים מרכזיים של מטבוליזם מתווך בכבד.

גורמי חילוף חומרים לא-חמצוניים של גופי קטון

הגורל השולט של קטונים הנגזרים מהכבד הוא חמצון חריג תלוי ב- SCOT. עם זאת, AcAc ניתן לייצא מיטוכונדריה ו מנוצלים במסלולים אנבוליים באמצעות המרה ACAc-COA על ידי תגובה תלויי ה- ATP מזוקק על ידי cytoplasmic acetoacetyl- סינתטיס COA (AACS, איור 1B). מסלול זה פעיל במהלך התפתחות המוח ובבלוטות החלב המניקה (מוריס, 2005, רובינסון וויליאמסון, 1978, Ohgami et al., 2003). AACS הוא גם לידי ביטוי מאוד ברקמת השומן, osteoclasts הופעל (Aguilo ואח ', 2010, Yamasaki ואח', 2016). Cytoplasmic AcAc-COA יכול להיות מכוונת על ידי cytosolic HMGCS1 לעבר biosynthesis ציטרולי, או נקרע על ידי אחד משני thiolases cytoplasmic כדי acetyl-CoA (ACAA1 ו ACAT2), carboxylated כדי malonyl-CoA, ולתרום סינתזה של חומצות שומן (ברגסטרום et , 1984, אדמונד, 1974, Endemann et al.

בעוד שהמשמעות הפיזיולוגית טרם נקבעה, קטונים יכולים לשמש מצעים אנבוליים אפילו בכבד. בהקשרים ניסיוניים מלאכותיים, AcAc יכול לתרום לכמחצית מהליפידים המסונתזים החדשים, ועד 75% מהכולסטרול החדש המסונתז (Endemann et al., 1982; Geelen et al., 1983; Freed et al., 1988). מכיוון ש- AcAc נגזר מחמצון שומן כבד לא שלם, היכולת של AcAc לתרום לליפוגנזה in vivo תרמז על רכיבה חסרת תועלת בכבד, כאשר ניתן להשתמש בקטונים שמקורם בשומן לייצור שומנים בדם, תפיסה שמשמעותה הפיזיולוגית מחייבת אימות ניסיוני, אך יכולה לשרת תפקידים אדפטיביים או לא מסתגלים (Solinas et al., 2015). AcAc מספקת בשקיקה כולסטרוגנזה, עם AACS Km-AcAc נמוך (~ 50 MM) המעדיף הפעלת AcAc גם במצב מוזן (Bergstrom et al., 1984). התפקיד הדינמי של מטבוליזם קטונים ציטופלזמי הוצע בנוירונים עובריים עכברים ראשוניים ובאדיפוציטים הנגזרים 3T3-L1, שכן מציאת AACS פגעה בבידול של כל סוג תאים (Hasegawa et al., 2012a; Hasegawa et al., 2012b). מציאת AACS בעכברים in vivo הורידה את הכולסטרול בסרום (Hasegawa et al., 2012c). SREBP-2, מווסת תעתיק ראשי לביוסינתזה של כולסטרול, וקולטן מופעל פרוקסיזום מופעל (PPAR) -? הם מפעילי תעתיק AACS, ומסדירים את תעתיקו במהלך התפתחות הנויריטים ובכבד (Aguilo et al., 2010; Hasegawa et al., 2012c). יחדיו, מטבוליזם בגוף קטון ציטופלזמי עשוי להיות חשוב בתנאים נבחרים או בהיסטוריה טבעית של מחלות, אך אינו מספיק להיפטר מגופי קטון שמקורם בכבד, שכן היפרקטונמיה מסיבית מתרחשת במסגרת פגיעה סלקטיבית בגורל החמצון הראשוני באמצעות אובדן מוטציות בתפקוד. ל- SCOT (ברי ואח ', 2001; קוטר ואח', 2011).

תקנה של HMGCS2 ו SCOT / OXCT1

ההבדלים בין המיטוכונדריה לבין הקידוד הגנטי של HMGCS, התרחשו בשלב מוקדם באבולוציה של החולייתנים בשל הצורך לתמוך בקטוגנזה בכבד במינים עם יחסי מוח גבוהים יותר למשקל הגוף (Boukaftane et al., 1994, Cunnane ו- Crawford, 2003). באופן טבעי מתרחש אובדן של תפקוד HMGCS2 מוטציות בבני אדם לגרום התקפי היפוגליקמיה hypoketotic (פיט ואח ', 2015, תומפסון ואח', 1997). ביטוי חזק של HMGCS2 מוגבל להפטוציטים ולאפיתל קולוני, והבעתו ופעילותו האנזימטית מתואמים באמצעות מנגנונים שונים (Mascaro et al., 1995, McGarry ו- Foster, 1980, רובינסון וויליאמסון, 1980). בעוד שההיקף המלא של מצבים פיזיולוגיים המשפיעים על HMGCS2 דורש הבהרה נוספת, ביטויו ו / או פעילותו מוסדרים במהלך תקופת הלידה המוקדמת, הזדקנות, סוכרת, הרעבה או בליעה של דיאטה קטוגנית (Balasse ו- Fery, 1989, Cahill GF Jr, 2006 ; Girard et al., 1992; Hegardt, 1999; Satapati et al., 2012; Sengupta et al., 2010). בעובר, מתילציה של אזור איגוף 5 של גן Hmgcs2 מתואמת באופן הפוך עם תעתיקו, והיא הפוכה חלקית לאחר הלידה (Arias et al., 1995; Ayte et al., 1993; Ehara et al., 2015; Ferre et al. ., 1983). באופן דומה, Bdh1 hepatic מציג דפוס ביטוי התפתחותי, ההולך וגדל מרגע הלידה ועד לגמילה, והוא נגרם גם על ידי דיאטה קטוגנית בגורם גידול פיברובלסטים (FGF) -21 (Badman et al., 2007, Zhang et al., 1989 ). קטוגנזה אצל יונקים מגיבה מאוד לאינסולין ולגלוקגון, מדוכאת ומעוררת, בהתאמה (McGarry ו- Foster, 1977). אינסולין מדכאת ליפוליזה של רקמת השומן, ובכך מונעת קטוגנזה של המצע שלה, בעוד שהגלוקגון מגביר את השטף הקטוגני באמצעות השפעה ישירה על הכבד (Hegardt, 1999). שעתוק Hmgcs2 מגורה על ידי גורם תעתיק forkhead FOXA2, אשר מעוכב באמצעות אינסולין-פוספטידילינוסיטול-3-kinase / Akt, והוא נגרם על ידי איתות glucagon-cAMP-p300 (Arias et al, 1995, Hegardt, 1999; Quant et al. , 1990; Thumelin et al., 1993, von Meyenn et al., 2013, Wolfrum et al., 2004, Wolfrum et al., 2003). PPAR? (Rodriguez et al., 1994) יחד עם מטרתו, FGF21 (Badman et al., 2007) גורמים לתעתיק Hmgcs2 בכבד במהלך רעב או מתן תזונה קטוגנית (Badman et al., 2007; Inagaki et al., 2007 ). אינדוקציה של PPAR? עשוי להתרחש לפני המעבר מפיזיולוגיה עוברית ליילודים, בעוד שניתן יהיה להעדיף הפעלת FGF21 בתקופת הילודים המוקדמת באמצעות עיכוב בתיווך OHB של deacetylase היסטון (HDAC) -3 (Rando et al., 2016). מעכב mTORC1 (מטרה של יונקים של קומפלקס רפמיצין 1) של PPAR? פעילות תעתיק מהווה גם מווסת מפתח לביטוי גנים Hmgcs2 (Sengupta et al., 2010), והכבד PER2, מתנד ראשי ממסד, מווסת בעקיפין את ביטוי ה- Hmgcs2 (Chavan et al., 2016). תצפיות אחרונות מצביעות על כך שאינטרלוקין -6 המושרה על ידי גידול מחוץ לכבד פוגע בקטוגנזה באמצעות PPAR? דיכוי (Flint et al., 2016).

פעילות האנזים HMGCS2 מוסדרת באמצעות מספר רב של PTM. HMGCS2 זרחון serine משופרת פעילותה במבחנה (Grimsrud et al., 2012). פעילות HMGCS2 מעכבת באופן אלסטוראלי על ידי succinyl-COA ו suysinylation ליזין ליזין (אריאס ואח ', 1995, הגארדט, 1999, Lowe ו Tubbs, 1985, Quant et al, 1990, Rardin ואח', 2013, ריד ואחרים, 1975; Thumelin ואח ', 1993). Succinylation של HMGCS2, HMGCL, ו BDH1 lysine שאריות המיטוכונדריה בכבד הם מטרות של NAD + תלוי decylase sirtuin 5 (SIRT5) (Rardin ואח ', 2013). פעילות HMGCS2 משופרת גם על ידי SycT3 deacetylation ליזין, וייתכן כי crosstalk בין acetylation ו succinylation מסדיר פעילות HMGCS2 (Rardin ואח ', 2013, Shimazu et, 2013). למרות היכולת של אלה PTMs להסדיר HMGCS2 Km ו Vmax, תנודות של אלה PTMs עדיין לא ממופה בקפידה ולא אושרו כנהגים מכניסטית של קטוגנזה in vivo.

SCOT מתבטא בכל התאים יונקים כי המיטוכונדריה הנמל, למעט אלה של hepatocytes. החשיבות של פעילות SCOT ו ketolysis הודגם עכברים SCOT-KO, אשר הציג קטלני אחיד עקב היפוגליקמיה היפוגליקמיה בתוך 48h לאחר הלידה (Cotter et al, 2011). רקמות ספציפיות של SCOT ב נוירונים או myocytes השלד גורם הפרעות מטבוליות במהלך רעב אבל הוא לא קטלני (Cotter et al., 2013b). אצל בני אדם, מחסור ב- SCOT מופיע מוקדם בחיים עם קטואסידוזיס חמור, גורם לתרדמות, הקאות ותרדמת (ברי ואח ', 2001, Fukao ואח', 2000, Kassovska-Bratinova ואח ', 1996, Niezen-Koning et al. , 1997, Saudubray ואחרים, 1987, Snyderman ואחרים, 1998, Tildon ו Cornblath, 1972). מעט יחסית ידוע ברמה התאית על גנים SCOT ו הרגולטור ביטוי חלבון. ביטוי OxctxNUMX mRNA וחלבון SCOT ופעילותם מצטמצמים במצבים קטוטיים, אולי באמצעות מנגנונים תלויי PPAR (Fenselau ו- Wallis, 1, Fenselau ו- Wallis, 1974, גרינבלט ואח ', 1976, אוקודה ואח', 1986, טורקו ואח ' ., 1991, Wentz ואח ', 2001). ב ketoacidosis סוכרתית, את חוסר התאמה בין קטוגנזה hepatic וחמצון חריגה הופך להחריף על ידי הפגיעה בפעילות SCOT. Overexpression של אינסולין עצמאית גלוקוז טרנספורטר (GLUT2010 / SLC1A2) ב cardiomyocytes גם מעכב ביטוי גנטי Oxct1 ו downregulates קטונים חמצון מסוף במצב לא קטוטי (יאן ואח ', 1). בכבד, Oxct2009 mRNA שפע הוא מדוכא על ידי microRNA-1 ו מתילציה היסטון H122K3me27, אשר ניכרים במהלך המעבר מעובר לתקופת הלידה (Thorrez et al., 3). עם זאת, דיכוי ביטוי כבד OxctXNXX בתקופה שלאחר הלידה מיוחסת בעיקר לפינוי של אבות Oxct2011- מבטאים אבות hematopoietic מהכבד, ולא הפסד של ביטוי קיים קודם Oxct1 ב hepatocytes מובחן באופן סופי. למעשה, ביטוי של mRNA Oxct1 ו SCOT חלבון hepatocytes מובחן הם נמוכים מאוד (אורי וכו ', 1).

SCOT מוסדר גם על ידי כספומטים. האנזים מצטבר יתר על המידה במוחם של עכברי SIRT3 KO, המציגים גם ייצור אצטיל-CoA תלוי ב- AcAc (Dittenhafer-Reed et al., 2015). ניטרציה לא אנזימטית של שאריות טירוזין של SCOT מחלישה גם את פעילותה, אשר דווחה בלבם של מודלים שונים של עכברים סוכרתיים (Marcondes et al., 2001; Turko et al., 2001; Wang et al., 2010a). לעומת זאת, ניטרציה של שאריות טריפטופן מגבירה את פעילות SCOT (Br g re et al., 2010; Rebrin et al., 2007). מנגנונים מולקולריים של ניטרציה או דה-ניטרציה ספציפיים לשאריות שנועדו לווסת את פעילות ה- SCOT עשויים להתקיים ודורשים בירור.

מחלוקות ב קטוגנזה אקסטרה

אצל יונקים האיבר הקטוגני העיקרי הוא כבד, ורק הפטוציטים ותאי אפיתל במעיים מבטאים בשפע את האיזופורם המיטוכונדריאלי של HMGCS2 (Cotter et al., 2013a; Cotter et al., 2014; McGarry and Foster, 1980; Robinson and Williamson, 1980) . תסיסה חיידקית אנאירובית של פוליסכרידים מורכבים מניבה בוטיראט, הנספג על ידי קולונוציטים אצל יונקים לצורך חמצון סופני או קטוגנזה (Cherbuy et al., 1995), שעשוי למלא תפקיד בבידול קולונוציטים (Wang et al., 2016). למעט תאי אפיתל במעיים והפטוציטים, HMGCS2 כמעט נעדר כמעט בכל תאי היונקים האחרים, אך הסיכוי לקטוגנזה מחוץ לכבד הועלה בתאי הגידול, באסטרוציטים של מערכת העצבים המרכזית, בכליות, בלבלב? תאים, אפיתל פיגמנט ברשתית (RPE) ואפילו בשרירי השלד (Adijanto et al., 2014; Avogaro et al., 1992; El Azzouny et al., 2016; Grabacka et al., 2016; Kang et al., 2015 ; Le Foll et al., 2014; Nonaka et al., 2016; Takagi et al., 2016a; Thevenet et al., 2016; Zhang et al., 2011). HMGCS2 חוץ רחמי נצפה ברקמות שחסרות יכולת קטוגנית נטו (Cook et al., 2016; Wentz et al., 2010), ו- HMGCS2 מציג פעילויות פוטנציאליות בלתי תלויות של קטוגנזה, "תאורת ירח", כולל בגרעין התא (Chen et al. , 2016; Kostiuk et al., 2010; Meertens et al., 1998).

לכל רקמה חוץ-כבדית המחמצנת גופי קטון יש פוטנציאל לצבור גופי קטון באמצעות מנגנונים עצמאיים של HMGCS2 (איור 2 א). עם זאת, אין רקמה אקסטרה-כבדת בה ריכוז גוף קטון במצב יציב עולה על מחזור הדם (Cotter et al., 2011; Cotter et al., 2013b; Harison and Long, 1940), ומדגיש כי גופי הקטון מועברים במורד שיפוע ריכוז באמצעות מנגנונים תלויי MCT1 / 2. מנגנון אחד של קטוגנזה חיצונית לכאורה עשוי לשקף פגיעה יחסית בחמצון הקטון. הסברים פוטנציאליים נוספים נופלים בתחום היווצרות גוף הקטון. ראשית, קטוגנזה דה נובו עשויה להתרחש באמצעות פעילות אנזימטית הפיכה של תיאולאז ו- SCOT (Weidemann and Krebs, 1969). כאשר ריכוז האצטיל-CoA גבוה יחסית, התגובות האחראיות בדרך כלל לחמצון AcAc פועלות בכיוון ההפוך (GOLDMAN, 1954). מנגנון שני מתרחש כאשר ביניים הנגזרים מ- חמצון מצטברים עקב צוואר בקבוק של מחזור TCA, AcAc-CoA מומר ל- l-? OHB-CoA באמצעות תגובה מזרזת על ידי המידוכונדריה 3-hydroxyacyl-CoA dehydrogenase, ובהמשך על ידי 3-hydroxybutyryl CoA deacylase ל- l-? OHB, שלא ניתן להבחין בספקטרומטר מסה או בספקטרוסקופיית תהודה מהאננטיומר הפיזיולוגי d-? OHB (ריד ואוזנד, 1980). ניתן להבדיל כרומטוגרפית או אנזימטית בין l-? OHB, והוא קיים ברקמות חוץ-כבדיות, אך לא בכבד או בדם (Hsu et al., 2011). קטוגנזה בכבד מייצרת רק d-? OHB, האננטיומר היחיד שהוא מצע BDH (Ito et al., 1984; Lincoln et al., 1987; Reed and Ozand, 1980; Scofield et al., 1982; Scofield et al., 1982). מנגנון שלישי שאינו תלוי ב- HMGCS2 מייצר d-? OHB באמצעות קטבוליזם של חומצות אמינו, במיוחד זה של לאוצין וליזין. מנגנון רביעי ניכר רק מכיוון שהוא נובע מחפץ תיוג ולכן מכונה פסאודוקטוגנזה. תופעה זו נובעת מהפיכותם של תגובות SCOT ותיולאז, ועלולה לגרום להערכת יתר של מחזור גוף הקטון עקב דילול איזוטופי של נותב גופני קטון ברקמות חוץ-כבדיות (Des Rosiers et al., 1990; Fink et al., 1988). . עם זאת, פסאודוקטוגנזה עשויה להיות זניחה ברוב ההקשרים (Bailey et al., 1990; Keller et al., 1978). סכמטי (איור 2 א ') מציין גישה שימושית ליישום תוך התחשבות בריכוז מוגבר של יציבות של קטונים.

הכליה קיבלה לאחרונה תשומת לב כאיבר קטוגני. ברוב המוחלט של המדינות, הכליה היא צרכן נטו של גופי קטון שמקורם בכבד, ומפריש או מגלם מחדש גופי קטון מזרם הדם, וכליות בדרך כלל אינן מחולל גוף או קטנטו לגוף קטון (רובינסון וויליאמסון, 1980). מחברי המחקר הקלאסי הגיעו למסקנה כי קטוגנזה מינימאלית של הכליה בכימות במערכת ניסוי מלאכותית אינה רלוונטית מבחינה פיזיולוגית (Weidemann and Krebs, 1969). לאחרונה, קטוגנזה כלייתית הוסברה במודלים של עכברים חסרי סוכרת ואוטופאגיה, אך סביר יותר כי שינויים מרובי איברים בהומאוסטזיס מטבולי משנים את חילוף החומרים של הקטון האינטגרטיבי באמצעות תשומות באיברים מרובים (Takagi et al., 2016a; Takagi et al., 2016b; ג'אנג ואח ', 2011). פרסום אחד האחרון הציע קטוגנזה כלייתית כמנגנון מגן מפני פגיעת איסכמיה-רפרפוזיה בכליה (Tran et al., 2016). ריכוזי מצב יציב מוחלטים של? OHB מתמציות של רקמת כליה של עכברים דווחו ב- ~ 4 מ"מ. כדי לבדוק אם זה היה בר קיימא, כימתנו את ריכוזי OHB בתמציות כליה מעכברים שנאכלו וצמו 12 שעות. ריכוזי OHB בסרום עלו מ ~ 24 מ"מ ל -100 מ"מ עם צום 2 שעות (איור 24 ב), בעוד שמצב יציב כלייתי? ריכוזי OHB בערך 2 מ"מ במצב האכלה, ורק 100 מ"מ במצב צום 1 שעות (איור 24C E), תצפיות העולות בקנה אחד עם הריכוזים שנכמתו לפני למעלה מ 2 שנה (המס וברוסנן, 45). זה אפשרי שבמצבים קטוטיים, גופי קטון שמקורם בכבד יכולים להיות מוגנים מחדש, אך עדויות לקטוגנזה כלייתית דורשות ביסוס נוסף. עדויות משכנעות התומכות בקטוגנזה חוץ-hepatic אמיתית הוצגו ב- RPE (Adijanto et al., 1970). הוצע טרנספורמציה מטבולית מסקרנת זו שאפשרה לאפשר לקטונים שמקורם ב- RPE לזרום לתאי קולטי אור או לתאי גליה מולר, אשר יכולים לסייע בהתחדשות הקטע החיצוני של קולטי האור.

? OHB כמתווך איתות

למרות שהם עשירים אנרגטית, גופי קטון מפעילים תפקידי איתות "לא-קנוניים" פרובוקטיביים בהומאוסטזיס הסלולרי (איור 3) (Newman and Verdin, 2014; Rojas-Morales et al., 2016). לדוגמא,? OHB מעכב HDACs מסוג I, מה שמגביר את האצטילציה של ההיסטון ובכך גורם לביטוי של גנים שמצמצמים את הלחץ החמצוני (Shimazu et al., 2013). OHB עצמו מהווה שינוי קוולנטי היסטוני בשאריות ליזין בכבד של עכברים סוכרתיים בצום או בסטרפטוזוטוצין (Xie et al., 2016) (ראה גם להלן, שילוב מטבוליזם בגוף הקטון, שינוי לאחר תרגום ופיזיולוגיה של תאים, וכן גופי קטון, לחץ חמצוני והגנה עצבית).

OHB הוא גם אפקטור באמצעות קולטנים מצמידים לחלבון G. באמצעות מנגנונים מולקולריים לא ברורים, הוא מדכא את פעילות מערכת העצבים הסימפתטית ומפחית את הוצאת האנרגיה הכוללת ואת קצב הלב על ידי עיכוב איתות חומצות שומן קצרות שרשרת דרך קולטן מצויד לחלבון G 41 (GPR41) (Kimura et al., 2011). אחת מתופעות האיתות הנחקרות ביותר של? OHB ממשיכה באמצעות GPR109A (הידוע גם בשם HCAR2), בן למשפחת המשנה GPCR של חומצה הידרוקרבוקסילית המתבטא ברקמות שומן (לבן וחום) (Tunaru et al., 2003), וב- תאים חיסוניים (אחמד ואח ', 2009). OHB הוא הליגנד האנדוגני היחיד הידוע של קולטן GPR109A (EC50 ~ 770 MM) המופעל על ידי d-? OHB, l-? OHB ובוטיראט, אך לא AcAc (Taggart et al., 2005). סף הריכוז הגבוה להפעלת GPR109A מושג באמצעות הקפדה על תזונה קטוגנית, רעב או במהלך קטואצידוזיס, מה שמוביל לעיכוב של ליפוליזת רקמת השומן. ההשפעה האנטי-ליפוליטית של GPR109A ממשיכה בעיכוב של אדניליל ציקלאז וירידה ב- cAMP, ומעכבת ליפאז טריגליצריד רגיש להורמונים (Ahmed et al., 2009; Tunaru et al., 2003). זה יוצר לולאת משוב שלילית בה קטוזיס מציב בלם מודולרי על הקטוגנזה על ידי צמצום שחרורן של חומצות שומן לא אסטרליות מאדיפוציטים (Ahmed et al., 2009; Taggart et al., 2005), השפעה שניתן לאזן באמצעות הדחף הסימפטי שמעורר ליפוליזה. ניאצין (ויטמין B3, חומצה ניקוטינית) הוא ליגנד חזק (EC50 ~ 0.1 MM) ל- GRP109A, שהופעל ביעילות במשך עשרות שנים לדיסליפידמיה (Benyo et al., 2005; Benyo et al., 2006; Fabbrini et al., 2010a; לוקאסובה ואח ', 2011; טונארו ואח', 2003). בעוד שניאצין משפר את הובלת הכולסטרול ההפוך במקרופאגים ומפחית נגעים טרשת עורקים (Lukasova et al., 2011), ההשפעות של OHB על נגעים טרשת עורקים נותרו לא ידועות. למרות שקולטן GPR109A ממלא תפקידי מגן, וקיימים קשרים מסקרנים בין שימוש בדיאטה קטוגנית בשבץ מוחי למחלות ניווניות (Fu et al., 2015; Rahman et al., 2014), תפקיד מגן של? OHB באמצעות GPR109A לא הוכח in vivo .

לבסוף,? OHB עשוי להשפיע על התיאבון והשובע. מטא-אנליזה של מחקרים שמדדה את ההשפעות של דיאטות קטוגניות ואנרגיה נמוכה מאוד הגיעה למסקנה שהמשתתפים הצורכים דיאטות אלה מציגים שובע גבוה יותר בהשוואה לדיאטות בקרה (Gibson et al., 2015). עם זאת, הסבר מתקבל על הדעת להשפעה זו הוא האלמנטים המטבוליים או ההורמונלים הנוספים שעשויים לווסת את התיאבון. לדוגמא, עכברים שנשמרו על דיאטה קטוגנית של מכרסמים הציגו הוצאות אנרגיה מוגברות בהשוואה לעכברים המוזנים בשליטה, למרות צריכת קלוריות דומה, ולפטין במחזור או גנים של פפטידים המסדירים את התנהגות האכלה לא שונו (Kennedy et al., 2007). בין המנגנונים המוצעים המציעים דיכוי תיאבון על ידי? OHB כולל גם איתות וגם חמצון (Laeger et al., 2010). מחיקה ספציפית של הפטוציטים של גן קצב היממה (Per2) ומחקרי חיסון של כרומטין החיסון גילה כי PER2 מפעיל ישירות את הגן Cpt1a, ומווסת בעקיפין את Hmgcs2, מה שמוביל לקטוזיס לקוי בעכברי נוקאאוט Per2 (Chavan et al., 2016). עכברים אלה הציגו ציפייה לקויה למזון, ששוחזרה חלקית על ידי ניהול מערכת OHB מערכתית. יש צורך במחקרים עתידיים בכדי לאשר את מערכת העצבים המרכזית כיעד ישיר של OHB והאם נדרשת חמצון קטון להשפעות שנצפו, או שמדובר במנגנון איתות אחר. חוקרים אחרים העלו את האפשרות לקטוגנזה מקומית שמקורם באסטרוציטים בתוך ההיפותלמוס המזרחי כווסת צריכת מזון, אך תצפיות ראשוניות אלה גם ייהנו מהערכות גנטיות ומבוססות על שטף (Le Foll et al., 2014). הקשר בין קטוזיס למחסור בחומרים מזינים נותר מעניין מכיוון שרעב ושובע הם אלמנטים חשובים בניסיונות הרזיה כושלים.

שילוב של מטבוליזם של גוף קטון, שינוי פוסט-טרנסלציוני ופיזיולוגיה של התא

גופי Ketone לתרום בריכות ממודרות של אצטיל- CoA, ביניים ביניים המציג תפקידים בולטים בחילוף החומרים הסלולר (Pietrocola et al., 2015). תפקיד אחד של acetyl-CoA הוא לשמש מצע עבור acetylation, שינוי היסטלי אנזימטלי היסטון קוולנטי שינוי (Choudhary et al., 2014, Dutta ואח ', 2016, מניפה וכו', 2015, Menzies ואח ', 2016 ). מספר רב של חלבונים מיטוכונדריאליים דינמיים, רבים מהם עשויים להתרחש באמצעות מנגנונים לא אנזימטיים, צמחו גם ממחקרי פרוטאומיקה חישובית (Dittenhafer-Reed et al., 2015; Hebert et al., 2013; Rardin et al., 2013 ; Shimazu ואח ', 2010). Dacetylases ליזין להשתמש cofactor אבץ (למשל, nucleocytosolic HDACs) או NAD + כמו מצע שיתוף (sirtuins, SIRTs) (Choudhary ואחרים, 2014, Menzies ואח ', 2016). Acetylproteome משמש גם חיישן ו effector של כלל אצטיל סלולר הבריכה COA, כמו מניפולציות פיזיולוגיות וגנטיות כל תוצאה של וריאציות לא אנזימטיות העולמי של acetylation (Weinert et al., 2014). כמו מטבוליטים תאיים לשמש מאפננים של acetylation שאריות ליזין, חשוב לשקול את התפקיד של גופי קטון, אשר שפע דינמי מאוד.

OHB הוא שינוי אפיגנטי באמצעות שני מנגנונים לפחות. רמות OHB מוגברות הנגרמות על ידי צום, הגבלה קלורית, ניהול ישיר או פעילות גופנית ממושכת מעוררות עיכוב HDAC או הפעלת היסטיל אצטילטרנספרז (Marosi et al., 2016; Sleiman et al., 2016) או למתח חמצוני (Shimazu et al., 2013) . עיכוב OHB של HDAC3 יכול לווסת את הפיזיולוגיה המטבולית של הילוד (Rando et al., 2016). באופן עצמאי,? OHB עצמו משנה ישירות את שאריות הליזין של ההיסטון (Xie et al., 2016). צום ממושך, או קטטואצידוזיס סוכרתית המושרה על ידי סטפטוזוטוצין הגבירו את ההיסטון? -הידרוקסי בוטירילציה. למרות שמספר האתרים של ליזין? -הידרוקסיביוטילציה ואצטילציה היה דומה, נצפתה היסטו-א-הידרוקסיביוטרילציה גדולה יותר מבאצטילציה. גנים מובחנים הושפעו מליזין היסטון לי-הידרוקסיבוטי, לעומת אצטילציה או מתילציה, דבר המצביע על פונקציות תאיות מובהקות. האם לא ידוע אם -Hydroxybutyrylation הוא ספונטני או אנזימטי, אך מרחיב את טווח המנגנונים באמצעות גופי קטון המשפיעים באופן דינמי על התעתיק.

ניתן לתווך אירועי תכנות חיוניים של תאים במהלך הגבלה קלורית ומחסור בחומרים תזונתיים ב- SIRT3 ו- SIRT5 תלויים בדה-דסצילציה ודיסוצינילציה של המיטוכונדריה, בהתאמה, תוך ויסות חלבונים קטוגניים וקטוליטיים ברמה שלאחר טרנסלוקציה ברקמות כבד ורקמות חוץ (Dittenhafer-Reed et al., 2015; Hebert et al., 2013; Rardin et al., 2013; Shimazu et al., 2010). למרות שהשוואה סטויוכיומטרית של אתרים תפוסים לא בהכרח מתקשרת ישירות לתזוזה בשטף חילוף החומרים, אצטילציה של המיטוכונדריה היא דינמית ועשויה להיות מונעת על ידי ריכוז אצטיל-CoA או pH מיטוכונדריאלי, ולא על ידי אצטיל-טרנספרזות אנזימטיות (Wagner and Payne, 2013). SIRT3 ו- SIRT5 מווסתים פעילויות של אנזימים המטבוליזם בגוף הקטון, מעוררים את שאלת תפקידם ההדדי של קטונים בפיסול האצטיל-פרוטאום, הסוצ'ניל-פרוטאום ומטרות תאיות דינמיות אחרות. ואכן, כאשר וריאציות של קטוגנזה משקפות ריכוזי NAD +, ייצור קטון ושפע יכולים לווסת את פעילות הסירטואין, ובכך להשפיע על סך בריכות האצטיל-CoA / succinyl-CoA, האציל-פרוטאום, ובכך פיזיולוגיה של המיטוכונדריה והתאים. ייצור הידרוקסיבוטרי של שאריות אנזים ליזין יכול להוסיף שכבה נוספת לתכנות מחדש של התא. ברקמות מחוץ לכבד, חמצון בגוף הקטון עשוי לעורר שינויים אנלוגיים בהומאוסטזיס התא. בעוד שתא של בריכות אצטיל-CoA מווסת מאוד ומתאם ספקטרום רחב של שינויים תאיים, יכולתם של גופי קטון לעצב באופן ישיר את ריכוזי האצטיל-CoA המיטוכונדריאליים והציטופלזמיים דורשת בירור (Chen et al., 2012; Corbet et al., 2016; Pougovkina et al., 2014; Schwer et al., 2009; Wellen and Thompson, 2012). מכיוון שריכוזי האצטיל-CoA מווסתים היטב, ואצטיל-CoA הוא ממברנה, חשוב לשקול את מנגנוני הנהג המתאמים את ההומאוסטזיס של אצטיל-CoA, כולל שיעורי הייצור וחמצון סופני במחזור TCA, המרה לגופי קטון, מיטוכונדריה זרם באמצעות קרניטין אצטיל-טרנספרז (CrAT), או ייצוא אצטיל-CoA לציטוזול לאחר המרה לציטראט ושחרור על ידי ATP ציטראט ליאז (ACLY). תפקידי המפתח של מנגנונים אלה בתאי אצטיל פרוטאום ובהומאוסטזיס דורשים הבנה תואמת של תפקידי הקטוגנזה וחמצון הקטונים (Das et al., 2015; McDonnell et al., 2016; Moussaieff et al., 2015; Overmyer et al., 2015; Seiler et al., 2014; Seiler et al., 2015; Wellen et al., 2009; Wellen and Thompson, 2012). טכנולוגיות מתכנסות במטבולומיקה ובאצטיל פרוטאומיקה בקביעת מודלים עם מניפולציה גנטית יידרשו לציין מטרות ותוצאות.

תגובות אנטי-פרו-דלקתיות לגופי קטון

קטוזיס וגופי קטון מווסתים דלקת ותפקוד תאים חיסוניים, אך הוצעו מנגנונים מגוונים ואפילו לא מתאימים. מחסור בחומרים מזינים ממושכים מפחית דלקת (Youm et al., 2015), אך הקטוזיס הכרוני של סוכרת מסוג 1 הוא מצב פרו-דלקתי (Jain et al., 2002; Kanikarla-Marie and Jain, 2015; Kurepa et al., 2012 ). תפקידי איתות מבוססי מנגנון עבור? OHB בדלקת מופיעים מכיוון שתאי מערכת חיסונית רבים, כולל מקרופאגים או מונוציטים, מבטאים בשפע את GPR109A. בעוד ש- OHB מפעיל תגובה אנטי-דלקתית ברובה (Fu et al., 2014; Gambhir et al., 2012; Rahman et al., 2014; Youm et al., 2015), ריכוזים גבוהים של גופי קטון, במיוחד AcAc, עשויים להיות. לעורר תגובה פרו-דלקתית (Jain et al., 2002; Kanikarla-Marie and Jain, 2015; Kurepa et al., 2012).

נבדקו תפקידים אנטי דלקתיים של ליגנדים GPR109A בטרשת עורקים, השמנת יתר, מחלות מעי דלקתיות, מחלות נוירולוגיות וסרטן (Graff et al., 2016). ביטוי GPR109A מוגבר בתאי RPE של מודלים סוכרתיים, חולי סוכרת אנושיים (Gambhir et al., 2012) ובמיקרוגליה במהלך ניוון עצבי (Fu et al., 2014). השפעות אנטי דלקתיות של? OHB משופרות על ידי ביטוי יתר של GPR109A בתאי RPE, ובוטלות על ידי עיכוב תרופתי או נוקאאוט גנטי של GPR109A (Gambhir et al., 2012). OHB וחומצה ניקוטינית אקסוגנית (Taggart et al., 2005), שניהם מקנים השפעות אנטי דלקתיות ב- TNF? או דלקת המושרה על ידי LPS על ידי הפחתת רמות החלבונים הפרו-דלקתיים (iNOS, COX-2), או ציטוקינים המופרשים (TNF ?, IL-1 ?, IL-6, CCL2 / MCP-1), בין השאר באמצעות עיכוב NF -? B טרנסלוקציה (Fu et al., 2014; Gambhir et al., 2012). OHB מפחית את מתח ה- ER ואת הדלקת NLRP3, ומפעיל את תגובת הלחץ האנטי-חמצונית (Bae et al., 2016; Youm et al., 2015). עם זאת, בדלקת ניוונית ניוונית, הגנה בתיווך OHR תלויה ב- GPR109A אינה כוללת מתווכים דלקתיים כמו איתות מסלול MAPK (למשל ERK, JNK, p38) (Fu et al., 2014), אך עשויה לדרוש COG-1 תלוי ב- PGD2 הפקה (רחמן ואח ', 2014). מסקרן כי נדרשת מקרופאג GPR109A להפעלת אפקט נוירו-מגן במודל שבץ מוחי איסכמי (Rahman et al., 2014), אך יכולתו של? OHB לעכב את דלקת ה- NLRP3 במקרופאגים הנגזרים ממוח העצם אינה תלויה ב- GPR109A (Youm et al. ., 2015). למרות שרוב המחקרים מקשרים בין? OHB להשפעות אנטי דלקתיות,? OHB עשוי להיות פרו דלקתי ולהגדיל סמנים של חמצון ליפידים בהפטוציטים של עגלים (Shi et al., 2014). השפעות אנטי-מול-דלקתיות של? OHB עשויות להיות תלויות בסוג התאים, בריכוז OHB, משך החשיפה ובנוכחותם או היעדרם של קואמפולטורים.

שלא כמו? OHB, AcAc עשוי להפעיל איתות פרו-דלקתי. AcAc מוגבר, במיוחד עם ריכוז גלוקוז גבוה, מעצים את הפגיעה בתאי האנדותל באמצעות מנגנון תלוי מתח אוקסידאז / NADPH (Kanikarla-Marie and Jain, 2015). ריכוזי AcAc גבוהים בחבל הטבור של אמהות סוכרתיות היו בקורלציה עם קצב חמצון חלבונים גבוה יותר וריכוז MCP-1 (Kurepa et al., 2012). AcAc גבוה בקרב חולי סוכרת היה בקורלציה עם TNF? ביטוי (Jain et al., 2002) ו- AcAc, אך לא? OHB, הביא ל- TNF ?, ביטוי MCP-1, הצטברות ROS, וירידה ברמת cAMP בתאי מונוציטים אנושיים U937 (Jain et al., 2002; Kurepa et al. ., 2012).

תופעות איתות תלויות גוף קטון מופעלות לעיתים קרובות רק בריכוזי גוף גבוהים של קטון (> 5 מ"מ), ובמקרה של מחקרים רבים שקושרים קטונים להשפעות פרו-או אנטי-דלקתיות, באמצעות מנגנונים לא ברורים. בנוסף, בשל ההשפעות הסותרות של? OHB לעומת AcAc על דלקת, והיכולת של יחס AcAc /? OHB להשפיע על פוטנציאל החמצון המיטוכונדריאלי, הניסויים הטובים ביותר להערכת התפקידים של גופי קטון על פנוטיפים תאיים משווים את ההשפעות של AcAc ו-? OHB ביחסים משתנים ובריכוזים מצטברים משתנים [למשל (Saito et al., 2016)]. לבסוף, ניתן לרכוש AcAc באופן מסחרי רק כמלח ליתיום או כאסתר אתילי הדורש הידרוליזה בסיסית לפני השימוש. קטיון ליתיום גורם באופן עצמאי למפל התמרה של אותות (Manji et al., 1995), ואניון AcAc הוא יציב. לבסוף ניתן לבלבל מחקרים המשתמשים ב- d / l-? OHB, מכיוון שרק ה- stereoisomer d-? OHB יכול להתחמצן ל- AcAc, אך d-? OHB ו- l-? OHB יכולים לאותת באמצעות GPR109A, לעכב את הדלקת NLRP3, ומשמשים מצעים ליפוגניים.

גופי קטון, מתח חמצוני ונוירופרוטקציה

מתח חמצוני מוגדר בדרך כלל כמצב בו ROS מוצג עודף, בגלל ייצור מוגזם ו / או חיסול לקוי. תפקידים מקלים על נוגדי חמצון ומתח חמצוני של גופי קטון תוארו באופן נרחב הן במבחנה והן ב- vivo, במיוחד בהקשר של הגנה עצבית. מכיוון שרוב הנוירונים אינם מייצרים ביעילות פוספטים בעלי אנרגיה גבוהה מחומצות שומן, אך הם מחמצנים את גופי הקטון כאשר הפחמימות חסרות, השפעות נוירו-מגן של גופי הקטון חשובות במיוחד (Cahill GF Jr, 2006; Edmond et al., 1987; Yang ואח ', 1987). במודלים של מתח חמצוני, אינדוקציה של BDH1 ודיכוי SCOT מצביעים על כך שניתן לתכנת מחדש את חילוף החומרים בגוף הקטון בכדי לקיים איתותים מגוונים של תאים, פוטנציאל החמצון או דרישות מטבוליות (Nagao et al., 2016; Tieu et al., 2003).

גופי קטון מפחיתים את דרגות הנזק הסלולרי, פציעה, מוות ואפופטוזיס תחתון בנוירונים ובקרדיומיוציטים (Haces et al., 2008; Maalouf et al., 2007; Nagao et al., 2016; Tieu et al., 2003). המנגנונים המופעלים מגוונים ולא תמיד קשורים באופן לינארי לריכוז. ריכוזים מילימולריים נמוכים של (d או l) -? OHB scovenge ROS (אניון הידרוקסיל), בעוד ש- AcAc מסלק מינים רבים של ROS, אך רק בריכוזים העולים על הטווח הפיזיולוגי (IC50 20 mM) (Haces et al., 67) . לעומת זאת, השפעה מועילה על פוטנציאל החיזור של שרשרת האלקטרונים היא מנגנון המקושר בדרך כלל ל- d-? OHB. בעוד שכל שלושת גופי הקטון (d / l-? OHB ו- AcAc) הפחיתו את מוות התאים העצביים ואת הצטברות ה- ROS המופעלת על ידי עיכוב כימי של גליקוליזה, רק d-? OHB ו- AcAc מנעו ירידה ב- ATP עצבית. לעומת זאת, במודל היפוגליקמי in vivo, (d או l) -? OHB, אך לא AcAc מנע את חמצון השומנים בהיפוקמפוס (Haces et al., 2008; Maalouf et al., 2008; Marosi et al., 2007; Murphy, 2016 ; Tieu et al., 2009). מחקרי in vivo של עכברים שניזונו מתזונה קטוגנית (2003% שומן בקק"ל ו -87% חלבון) הציגו וריאציה נוירו-אנטומית של יכולת נוגדת חמצון (Ziegler et al., 13), שם נצפו השינויים העמוקים ביותר בהיפוקמפוס, עם עליית גלוטתיון פרוקסידאז ובסך הכל. יכולות נוגדות חמצון.

תזונה קטוגנית, אסטרים של קטונים (ראו גם שימוש טיפולי בתזונה קטוגנית ובגופי קטון אקסוגניים), או במתן OHB מגן על הגנה עצבית במודלים של שבץ איסכמי (Rahman et al., 2014); מחלת פרקינסון (Tieu et al., 2003); התקף רעילות חמצן במערכת העצבים המרכזית (D'Agostino et al., 2013); עוויתות אפילפטיות (Yum et al., 2015); אנצפלומיופתיה מיטוכונדריאלית, חומצה לקטית ותסמונת פרקים דמויי שבץ מוחי (MELAS) (Frey et al., 2016) ומחלת אלצהיימר (Cunnane and Crawford, 2003; Yin et al., 2016). לעומת זאת, דוח שנערך לאחרונה הוכיח עדויות היסטופתולוגיות להתקדמות ניוונית על ידי תזונה קטוגנית במודל עכבר מהונדס של תיקון DNA מיטוכונדריאלי חריג, למרות עלייה בביוגנזה של המיטוכונדריה וחתימות נוגדות חמצון (Lauritzen et al., 2016). דיווחים סותרים אחרים מצביעים על כך שחשיפה לריכוזי גוף גבוהים של קטון מעוררת מתח חמצוני. מינונים גבוהים של OHB או AcAc גרמו להפרשת תחמוצת החנקן, חמצון שומנים בדם, ביטוי מופחת של SOD, גלוטתיון פרוקסידאז וקטלאז בהפטוציטים של עגל, ואילו בהפטוציטים של חולדות, אינדוקציה של מסלול MAPK יוחסה ל- AcAc אך לא ל- OHB (Abdelmegeed et al., 2004) ; שי ואח ', 2014; שי ואח', 2016).

יחדיו, רוב הדיווחים מקשרים בין OHB לירידת מתח חמצוני, שכן מתן מעכב ייצור ROS / סופר-חמצני, מונע חמצון ליפידים וחמצון חלבון, מגביר את רמות החלבון נוגדי החמצון ומשפר את הנשימה המיטוכונדריאלית ואת ייצור ה- ATP (Abdelmegeed et al., 2004; Haces et al., 2008; Jain et al., 1998; Jain et al., 2002; Kanikarla-Marie and Jain, 2015; Maalouf et al., 2007; Maalouf and Rho, 2008; Marosi et al., 2016; Tieu ואח ', 2003; יין ואח', 2016; זיגלר ואח ', 2003). בעוד ש- AcAc נמצא בקורלציה ישירה יותר מ- OHB עם אינדוקציה של מתח חמצוני, לא תמיד תופעות אלו מנותחות בקלות מתגובות פרו-דלקתיות פוטנציאליות (Jain et al., 2002; Kanikarla-Marie and Jain, 2015; Kanikarla-Marie and ג'יין, 2016). יתר על כן, קריטי לשקול כי התועלת האנטי-אוקסידנטית לכאורה שמקנה דיאטות קטוגניות פלאי-טרופיות עשויה שלא להיות מועברת על ידי גופי קטון עצמם, והגנה עצבית המוענקת על ידי גופי קטון עשויה שלא להיות מיוחסת לחלוטין למתח חמצוני. לדוגמא במהלך מחסור בגלוקוז, במודל של מחסור בגלוקוז בתאי עצב בקליפת המוח,? OHB עורר שטף אוטופגי ומנע הצטברות אוטופגוזום, שהיה קשור לירידה במוות עצבי (Camberos-Luna et al., 2016). d-? OHB גורם גם לחלבונים נוגדי חמצון קנוניים FOXO3a, SOD, MnSOD ו- catalase, באופן פרוספקטיבי באמצעות עיכוב HDAC (Nagao et al., 2016; Shimazu et al., 2013).

מחלת כבד כבד לא-אלכוהולית (NAFLD) ומטבוליזם של גוף קטון

NAFLD הקשורים להשמנה וסטאטהפטיטיס לא אלכוהולי (NASH) הם הגורמים השכיחים ביותר למחלות כבד במדינות המערב (Rinella and Sanyal, 2016), ואי ספיקת כבד הנגרמת על ידי NASH היא אחת הסיבות השכיחות ביותר להשתלת כבד. בעוד שאחסון עודף של טריאצילגליצרולים בהפטוציטים> 5% ממשקל הכבד (NAFL) בלבד אינו גורם לתפקוד כבד ניווני, ההתקדמות ל- NAFLD בבני אדם מתואמת עם עמידות מערכתית לאינסולין ועלייה בסיכון לסוכרת מסוג 2, ועשויה לתרום לפתוגנזה של מחלות לב וכלי דם ומחלות כליות כרוניות (Fabbrini et al., 2009; Targher et al., 2010; Targher and Byrne, 2013). המנגנונים הפתוגניים של NAFLD ו- NASH אינם מובנים לחלוטין אך כוללים הפרעות בחילוף החומרים של הפטוציטים, אוטופאגיה של הפטוציטים ומתח של הרשתית האנדופלזמית, תפקוד תאי החיסון בכבד, דלקת ברקמת השומן ומגשרים דלקתיים מערכתיים (Fabbrini et al., 2009; Masuoka ו- Chalasani, 2013 ; Targher et al., 2010; Yang et al., 2010). הפרעות במטבוליזם של פחמימות, ליפידים וחומצות אמיניות מתרחשות ותורמות להשמנה, סוכרת ו- NAFLD בבני אדם ובאורגניזמים מודליים [נבדקו ב- (Farese et al., 2012; Lin and Accili, 2011; Newgard, 2012; Samuel and שולמן, 2012; סאן ולזר, 2013)]. בעוד שחריגות הפטוציטים בחילוף החומרים השומני הציטופלזמי נצפות בדרך כלל ב- NAFLD (Fabbrini et al., 2010b), תפקיד מטבוליזם המיטוכונדריה, השולט בסילוק חמצוני של שומנים, פחות ברור בפתוגנזה של NAFLD. חריגות של חילוף החומרים המיטוכונדריה מתרחשות בפתוגנזה של NAFLD / NASH (Hyotylainen et al., 2016; Serviddio et al., 2011; Serviddio et al., 2008; Wei et al., 2008). יש כללי (Felig et al., 1974; Iozzo et al., 2010; Koliaki et al., 2015; Satapati et al., 2015; Satapati et al., 2012; Sunny et al., 2011) אבל לא אחיד ( קוליאקי ורודן, 2013; פרי ואח ', 2016; רקטור ואח', 2010) הסכמה כי לפני התפתחות NASH בתום לב, חמצון מיטוכונדריאלי בכבד, ובמיוחד חמצון שומן, מתוגבר בהשמנת יתר, עמידות לאינסולין מערכתית. , ו- NAFLD. סביר להניח שככל שמתקדמת NAFLD, הופעת ההטרוגניות של יכולת חמצון, אפילו בקרב המיטוכונדריה הפרטנית, ובסופו של דבר תפקוד החמצון נפגע (Koliaki et al., 2015; Rector et al., 2010; Satapati et al., 2008; Satapati et al. ., 2012).

קטוגנזה משמשת לעתים קרובות כפרוקסי לחמצון שומן בכבד. ליקויים בקטוגנזה מתגלים ככל שמתקדמת NAFLD במודלים של בעלי חיים, וסביר להניח שבבני אדם. באמצעות מנגנונים שהוגדרו לחלוטין, היפר-אינסולינמיה מדכא קטוגנזה, ואולי תורם להיפוקטונמיה בהשוואה לבקרות רזות (Bergman et al., 2007; Bickerton et al., 2008; Satapati et al., 2012; Soeters et al., 2009; Sunny et al. , 2011; סגן ואח ', 2005). עם זאת, היכולת של מחזורי ריכוזי קטון בגוף לחזות NAFLD שנויה במחלוקת (Mnnist et al., 2015; Sanyal et al., 2001). שיטות ספקטרוסקופיות כמותיות חזקות של תהודה מגנטית במודלים של בעלי חיים גילו שיעור מוגבר של מחזור הקטון עם עמידות מתונה לאינסולין, אך שיעורי ירידה ניכרו עם עמידות חמורה יותר לאינסולין (Satapati et al., 2012; Sunny et al., 2010). בבני אדם שמנים עם כבד שומני, שיעור הקטוגני הוא תקין (Bickerton et al., 2008; Sunny et al., 2011), ומכאן, שיעורי הקטוגנזה פחתים ביחס לעומס מוגבר של חומצות השומן בתוך הפטוציטים. כתוצאה מכך, אצטיל-CoA הנגזר מ- חמצון עשוי להיות מופנה לחמצון סופני במחזור TCA, להגברת החמצון הסופי, גלוקונאוגנזה מונע על ידי פוספואנולפירואט באמצעות אנפלרוזיס / קטפלרוזיס ומתח חמצוני. Acetyl-CoA עשוי גם לעבור ייצוא ממיטוכונדריה כציטראט, מצע מבשר לליפוגנזה (איור 4) (Satapati et al., 2015; Satapati et al., 2012; Solinas et al., 2015). בעוד שהקטוגנזה הופכת פחות תגובה לאינסולין או לצום עם השמנת יתר ממושכת (Satapati et al., 2012), המנגנונים הבסיסיים וההשלכות במורד הזרם של זה נותרו מובנים לחלוטין. עדויות עדכניות מצביעות על כך ש- mTORC1 מדכא קטוגנזה באופן שעשוי להיות במורד הזרם לאיתור האינסולין (Kucejova et al., 2016), התואם את התצפיות ש- mTORC1 מעכב אינדוקציה של Hmgcs2 של PPAR? (Sengupta et al., 2010) ( ראה גם תקנה של HMGCS2 ו- SCOT / OXCT1).

תצפיות ראשוניות מקבוצתנו מצביעות על השלכות כבדות שליליות של אי ספיקה קטוגנית (Cotter et al., 2014). כדי לבדוק את ההשערה לפגיעה בקטוגנזה, אפילו במצבים מלאים בפחמימות ובכך במצבים "לא קטוגניים", תורמת לחילוף החומרים הלא תקין של גלוקוז ומעוררת סטטו-הפטיטיס, יצרנו מודל עכבר של אי ספיקה קטוגנית ניכרת על ידי מתן אוליגו-גרעינים נוגדי חושים (ASO) הממוקדים Hmgcs2. אובדן HMGCS2 בעכברים בוגרים סטנדרטיים דלי שומן הניזונים משומן גרמה להיפרגליקמיה קלה והגדילה באופן ניכר את הייצור של מאות מטבוליטים בכבד, שחבילה שלהם הציעה בחום הפעלת ליפוגנזה. האכלה בתזונה עתירת שומן של עכברים עם קטוגנזה לא מספק הובילה לפגיעה נרחבת בכבד ולדלקת. ממצאים אלה תומכים בהשערות המרכזיות לפיהן (i) קטוגנזה איננה מסלול הצפה פסיבי אלא צומת דינמית בהומאוסטזיס פיזיולוגי בכבד ומשולב, וכן (ii) הגדלה קטוגנית נבונה להפחתת NAFLD / NASH ומטבוליזם של גלוקוז בכבד מופרע ראוי לבדיקה. .

כיצד עלול לקטוגנזה לקויה לתרום לפגיעה בכבד ולשינוי הומאוסטזיס של הגלוקוז? השיקול הראשון הוא האם האשם הוא מחסור בשטף קטוגני, או קטונים עצמם. דו"ח שנערך לאחרונה מציע כי גופי קטון עשויים למתן פגיעה בכבד הנגרמת מלחץ חמצוני כתגובה לחומצות שומן רב בלתי רוויות n-3 (Pawlak et al., 2015). כזכור, בגלל חוסר ביטוי של SCOT בהפטוציטים, גופי הקטון אינם מחומצנים, אך הם יכולים לתרום לליפוגנזה, ולשרת מגוון תפקידי איתות ללא תלות בחמצון שלהם (ראה גם גורלות מטבוליים שאינם מחמצנים של גופי קטון ו-? OHB כ מגשר איתות). יתכן גם שגופי קטון שמקורם בהפטוציטים עשויים לשמש אות ו / או מטבוליט לסוגי תאים שכנים בתוך האצינוס הכבד, כולל תאי כוכבים ומקרופאגים של תאי Kupffer. למרות שהספרות המוגבלת הקיימת מעידה על כך שמקרופאגים אינם מסוגלים לחמצן גופי קטון, הדבר נמדד רק באמצעות מתודולוגיות קלאסיות, ורק במקרופאגים פריטונאליים (Newsholme et al., 1986; Newsholme et al., 1987), דבר המצביע על כך ש- ההערכה מתאימה בהתחשב בביטוי SCOT בשפע במקרופאגים שמקורם במח העצם (Youm et al., 2015).

השטף הקטוגני של הפטוציטים עשוי גם להיות מגן על ציטוטים. בעוד שמנגנוני ההכרה עשויים שלא להיות תלויים בקטוגנזה כשלעצמה, דיאטות קטוגניות דלות בפחמימות נקשרו לשיפור ב- NAFLD (Browning et al., 2011; Foster et al., 2010; Kani et al., 2014; Schugar and Crawford, 2012) . התצפיות שלנו מצביעות על כך שקטוגנזה של הפטוציטים עשויה להעביר משוב ולווסת את שטף מחזור ה- TCA, את השטף האפלרוטי, את הגלוקונאוגנזה הנגזרת מפוספונולפירובט (Cotter et al., 2014) ואפילו מחזור גליקוגן. ליקוי קטוגני מכוון את אצטיל-CoA להגביר את שטף ה- TCA, אשר בכבד נקשר לפגיעה מוגברת בתיווך ROS (Satapati et al., 2015; Satapati et al., 2012); מכריח הסטת פחמן למיני שומנים מסונתזים דה נובו שעלולים להוכיח ציטוטוקסיות; ומונע חמצון מחדש של NADH ל- NAD + (Cotter et al., 2014) (איור 4). יחדיו, נדרשים ניסויים עתידיים לטיפול במנגנונים שבאמצעותם אי ספיקה קטוגנית יחסית עלולה להיות בלתי-מסתגלת, לתרום להיפרגליקמיה, לעורר סטטו-הפטיטיס והאם מנגנונים אלה פעילים ב- NAFLD / NASH האנושי. כראיות אפידמיולוגיות מצביעות על פגיעה בקטוגנזה במהלך התקדמות דלקת המוח (Embade et al., 2016; Marinou et al., 2011; M nnist et al., 2015; Pramfalk et al., 2015; Safaei et al., 2016) טיפולים המגבירים קטוגנזה בכבד יכולים להוכיח את ההשלכה (Degirolamo et al., 2016; Honda et al., 2016).

גופי Ketone וכישלון לב (HF)

עם קצב חילוף חומרים העולה על 400 קק"ל / ק"ג ליום ומחזור של 6 ק"ג ATP ליום, הלב הוא האיבר בעל ההוצאה האנרגטית הגבוהה ביותר והביקוש לחמצון (Ashrafian et al., 35; Wang et al., 2007 ב). הרוב המכריע של מחזור האנרגיה בשריר הלב נמצא בתוך המיטוכונדריה, ו -2010% מההיצע הזה מקורו ב- FAO. הלב הכלכלי וגמיש בתנאים רגילים, אך הלב המחדש פתולוגי (למשל עקב יתר לחץ דם או אוטם שריר הלב) והלב הסוכרת הופכים כל אחד לגמיש מטבולית (Balasse and Fery, 70; BING, 1989; Fukao et al., 1954 ; Lopaschuk et al., 2004; Taegtmeyer et al., 2010; Taegtmeyer et al., 1980; Young et al., 2002). ואכן, חריגות מתוכנתות גנטית של מטבוליזם של דלק לב במודלים של עכברים מעוררות קרדיומיופתיה (Carley et al., 2002; Neubauer, 2014). בתנאים פיזיולוגיים לבבות נורמליים מחמצנים גופי קטון ביחס למסירתם, על חשבון חמצון חומצות שומן וגלוקוז, ושריר הלב הוא הצרכן הגבוה ביותר בגוף הקטון ליחידת מסת (BING, 2007; Crawford et al., 1954; GARLAND et al. ., 2009; Hasselbaink et al., 1962; Jeffrey et al., 2003; Pelletier et al., 1995; Tardif et al., 2007; Yan et al., 2001). בהשוואה לחמצון חומצות שומן, גופי קטון יעילים יותר מבחינה אנרגטית, ומניבים יותר אנרגיה זמינה לסינתזת ATP לכל מולקולה של חמצן שהושקע (יחס P / O) (Kashiwaya et al., 2009; Sato et al., 2010; Veech, 1995) . חמצון גוף קטון גם מניב אנרגיה גבוהה יותר מ- FAO, תוך שמירה על חמצון של אוביקווינון, מה שמגדיל את טווח החמצון בשרשרת הובלת האלקטרונים והופך יותר אנרגיה לזמינה לסינתזה של ATP (Sato et al., 2004; Veech, 1995). חמצון של גופי קטון עשוי גם לצמצם את ייצור ה- ROS, ובכך מתח חמצוני (Veech, 2004).

מחקרים ראשוניים התערבות התצפית מצביעים על תפקיד פוטנציאלי של גופים קטון בלב. בהקשר של ניסוי איסכמיה / reperfusion ניסיוני, גופי ketone העניקו השפעות קרדיופרטיביות אפשריות (Al-Zaid et al., 2007, Wang et al., 2008), אולי בשל העלייה בשכיחות המיטוכונדריאלית בלב או בויסות של זרחון חמצוני חיוני מתווכים (Snorek et al., 2012; Zou et al., 2002). מחקרים אחרונים מצביעים על כך שהשימוש בגופני קטון גדל בלבבות עכברים כושלים (Aubert et al, 2016) ובני אדם (Bedi et al, 2016), התומכים בתצפיות מוקדמות בבני אדם (BING, 1954, Fukao et al, 2000; ג'נרדאן ואח ', 2011, לונגו ואח', 2004, רודולף ושנץ, 1973, Tildon ו- Cornblath, 1972). ריכוז גדילי קטון מוגבר אצל חולי אי ספיקת לב, ביחס ישיר ללחצי מילוי, תצפיות שמנגנוןן וחשיבותן אינן ידועות (Kupari et al, 1995, Lommi et al., 1996, Lommi et al., 1997; Neely et al , 1972), אבל עכברים עם חסר SCOT סלקטיבית cardiomyocytes התערוכה שיפוץ מואץ חדריית פתולוגית וחתימות ROS בתגובה פגיעה בלחץ יתר המושרה לחץ כירורגי (Schugar et al., 2014).

תצפיות מסקרנות האחרונות בטיפול בסוכרת חשפו קשר פוטנציאלי בין חילוף החומרים של קטון בשריר הלב לבין שיפוץ חדרי הלב הפתולוגי (איור 5). עיכוב של נתרן צינורי פרוקסימלי / גלוקוז שיתוף טרנספורטר 2 (SGLT2i) מגדילה את ריכוזי הגוף קטון בבני אדם (Ferrannini et al, 2016a, Inagaki et al., 2015) ועכברים (סוזוקי ואח ', 2014) דרך גדל (Frannini et al, 2014, Ferrannini et al, 2016a, כץ ולייטר, 2015, Mudaliar et al, 2015). באופן מפתיע, לפחות אחד מהסוכנים הללו הפחית את אשפוז ה- HF (למשל, כפי שהתגלה על-ידי מחקר ה- EMPA-REG OUTCOME) ותמותה קרדיווסקולארית משופרת (Fitchett et al, 2016, Sonesson et al., 2016; Wu et al., 2016a , זינמן ואחרים, 2015). בעוד שמנגנוני הנהיגה שמאחורי תוצאות ה- HF המועילות ל- SGLT2i מקושרים באופן פעיל, יתרון ההישרדות עשוי להיות רב-תכליתי, כולל פרוקטקטיבי, כולל השפעות משלימות על משקל, לחץ דם, רמות גלוקוז ורמת חומצת השתן, קשיחות עורקים, מערכת העצבים הסימפתטית, אוסמוטי dioresis / נפח פלזמה מופחת, והגדילה hematocrit (רז ו Cahn, 2016, Vallon ו Thomson, 2016). יחד עם זאת, הרעיון כי הגדלת קטונמיה טיפולית בחולי HF, או אלו הנמצאים בסיכון גבוה לפתח HF, נשאר שנוי במחלוקת, אך הוא נמצא תחת חקירה פעילה במחקרים קליניים ופרה-קליניים (Ferrannini et al., 2016b, Kolwicz et al. 2016, Lopaschuk ו Verma, 2016, Mudaliar ואח ', 2016, Taegtmeyer, 2016).

גופי קטון בביולוגיה של הסרטן

הקשר בין גופי קטון לסרטן מתפתח במהירות, אך מחקרים במודלים של בעלי חיים ובני אדם הניבו מסקנות שונות. מכיוון שמטבוליזם של קטון הוא תגובה דינמית ומזינתית, הוא מפתה לעקוב אחר קשרים ביולוגיים לסרטן בשל הפוטנציאל של טיפולים תזונתיים מדויקים. תאי סרטן עוברים תכנות מחדש מטבולי על מנת לשמור על התפשטות תאים מהירה וצמיחה (DeNicola ו- Cantley, 2015, Pavlova ו- Thompson, 2016). האפקט הקלאסי של ורבורג בחילוף החומרים בתאי הסרטן נובע מהתפקיד הגומי של הגליקוליזה ותסיסת חומצת החלב כדי להעביר אנרגיה ולפצות על תלות נמוכה יותר בזירחון חמצוני ובנשימה מיטוכונדריאלית מוגבלת (De Feyter et al., 2016; Grabacka et al., 2016; Kang et al., 2015, Poff et al., 2014, Shukla et al., 2014). גלוקוז הפחמן מופנה בעיקר באמצעות גליקוליזה, נתיב פוספט pentose, ו lipogenesis, אשר יחד לספק intermediates הדרושים להרחבת ביומסה הגידול (Grabacka ואח ', 2016, Shukla et, 2014, Yoshii ואח', 2015). ההסתגלות של תאים סרטניים למניעת גלוקוז מתרחשת באמצעות היכולת לנצל מקורות דלק חלופיים, כולל אצטט, גלוטמין ואספרט (Jaworski et al., 2016; Sullivan et al., 2015). לדוגמה, הגישה המוגבלת לפירובט מגלה את היכולת של תאים סרטניים להמיר גלוטמין לתוך אצטיל- COA על ידי carboxylation, שמירה על צרכים אנרגטיים אנאבוליים (יאנג ואח ', 2014). הסתגלות מעניינת של תאים סרטניים היא ניצול של אצטט כדלק (Comerford et al., 2014, Jaworski et al., 2016; Mashimo et al., 2014; רייט וסימון, 2016, Yoshii ואח ', 2015). אצטט הוא גם מצע לליפוגנזה, שהוא קריטי עבור התפשטות תאי הגידול, והרווח של צינור ליפוגני זה קשור להישרדות מטופלים קצרה יותר ולנטל גידול גדול יותר (Comerford et al., 2014; Mashimo et al., 2014; Yoshii et al ., 2015).

תאים שאינם סרטניים מעבירים בקלות את מקור האנרגיה שלהם מגלוקוז לגופי קטון במהלך מחסור בגלוקוז. פלסטיות זו עשויה להיות משתנה יותר בקרב סוגי תאים סרטניים, אך גידולי מוח מושתלים in vivo התחמצנו [2,4-13C2] -? OHB במידה דומה לרקמת המוח המקיפה (De Feyter et al., 2016). מודלים של "אפקט ורבורג הפוך" או "שני מטבוליזם של גידולים בתאים" משערים כי תאים סרטניים גורמים לייצור OHB בפיברובלסטים סמוכים, המספקים את צורכי האנרגיה של תא הגידול (Bonuccelli et al., 2010; Martinez-Outschoorn et al., 2012). . בכבד, מעבר בהפטוציטים מקטוגנזה לחמצון קטון בתאי קרצינומה hepatocellular (hepatoma) תואם להפעלה של פעילויות BDH1 ו- SCOT שנצפו בשתי שורות תאי hepatoma (Zhang et al., 1989). ואכן, תאי הפטומה מבטאים OXCT1 ו- BDH1 ומחמצנים קטונים, אך רק כאשר סרום מורעב (Huang et al., 2016). לחלופין, הוצע גם קטוגנזה של תאי גידול. שינויים דינמיים בביטוי גנים קטוגניים מוצגים במהלך טרנספורמציה סרטנית של אפיתל המעי הגס, סוג תאים המבטא בדרך כלל את HMGCS2, ודוח שנערך לאחרונה העלה כי HMGCS2 עשוי להיות סמן פרוגנוסטי של פרוגנוזה גרועה בקרצינומות של תאי המעי הגס והקשקש (Camarero et al., 2006; חן ואח ', 2016). האם קשר זה מחייב או כרוך בקטוגנזה, או פונקציה של אור הירח של HMGCS2, נותר לקבוע. לעומת זאת, לכאורה ייצור OHB על ידי מלנומה ותאי גליובלסטומה, מגורה על ידי ה- PPAR? אגוניסט fenofibrate, היה קשור למעצר גדילה (Grabacka et al., 2016). מחקרים נוספים נדרשים כדי לאפיין תפקידים של ביטוי HMGCS2 / SCOT, קטוגנזה וחמצון קטון בתאים סרטניים.

מעבר לתחום חילוף החומרים בדלק, קטונים היו מעורבים לאחרונה בביולוגיה של תאים סרטניים באמצעות מנגנון איתות. ניתוח של מלנומה BRAF-V600E + הצביע על אינדוקציה תלויה ב- OCT1 של HMGCL באופן תלוי ב- BRAF אונקוגני (Kang et al., 2015). הגדלת HMGCL הייתה בקורלציה עם ריכוז AcAc תאי גבוה יותר, אשר בתורו שיפר את האינטראקציה של BRAFV600E-MEK1, והגביר את איתות MEK-ERK בלולאה הזנה המניעה התפשטות וצמיחה של תאי הגידול. תצפיות אלה מעלות את השאלה המסקרנת של קטוגנזה חוץ-כבדת פוטנציאל התומכת אז במנגנון איתות (ראה גם? OHB כמתווך איתות ומחלוקות בקטוגנזה חוץ-כבדית). חשוב גם לבחון את ההשפעות העצמאיות של AcAc, d-? OHB ו- l-? OHB על חילוף החומרים בסרטן, וכאשר שוקלים HMGCL, גם קטבוליזם של לאוצין עלול להיפגע.

ההשפעות של דיאטות קטוגניות (ראה גם שימוש טיפולי בתזונה קטוגנית ובגופי קטון אקסוגניים) במודלים של בעלי חיים בסרטן מגוונות (De Feyter et al., 2016; Klement et al., 2016; Meidenbauer et al., 2015; Poff et al. ., 2014; Seyfried et al., 2011; Shukla et al., 2014). בעוד שנחשבים קשרים אפידמיולוגיים בין השמנת יתר, סרטן ודיאטות קטוגניות (Liskiewicz et al., 2016; Wright and Simone, 2016), מטא-אנליזה באמצעות דיאטות קטוגניות במודלים של בעלי חיים ובמחקרים בבני אדם הציעה השפעה מכריעה על ההישרדות, עם יתרונות הקשורים באופן פרוספקטיבי לגודל הקטוזיס, זמן התחלת הדיאטה ומיקום הגידול (Klement et al., 2016; Woolf et al., 2016). טיפול בתאי סרטן הלבלב עם גופי קטון (d-? OHB או AcAc) עיכב צמיחה, התפשטות וגליקוליזה, ודיאטה קטוגנית (81% קק"ל שומן, 18% חלבון, 1% פחמימה) הפחיתה משקל גידול in vivo, גליקמיה, ו הגדלת שריר ומשקל הגוף בבעלי חיים עם סרטן מושתל (Shukla et al., 2014). תוצאות דומות נצפו באמצעות מודל תאי גליובלסטומה גרורתי בעכברים שקיבלו תוסף קטון בתזונה (Poff et al., 2014). לעומת זאת, דיאטה קטוגנית (91% שומן קק"ל, 9% חלבון) הגדילה את ריכוז ה- OHB במחזור הדם והפחיתה את הגליקמיה, אך לא הייתה השפעה על נפח הגידול או על משך ההישרדות בחולדות נושאות גליומה (De Feyter et al., 2016). אינדקס קטון לגלוקוז הוצע כמדד קליני המשפר את הטיפול המטבולי בטיפול בסרטן המוח הנגרם על ידי דיאטה קטוגנית בבני אדם ובעכברים (Meidenbauer et al., 2015). יחדיו, התפקידים של חילוף החומרים בגוף הקטון וגופי הקטון בביולוגיה של סרטן מרתקים מכיוון שלכל אחד מהם אפשרויות טיפוליות ניתנות לניתוח, אך נותר להבהיר היבטים בסיסיים, עם השפעות ברורות העולות ממטריצה ​​של משתנים, כולל (i) הבדלים בין קטון אקסוגני. גופים לעומת תזונה קטוגנית, (ii) סוג תאים סרטניים, פולימורפיזם גנומי, דרגה ושלב; (iii) תזמון ומשך החשיפה למצב הקטוטי.

ד"ר חימנז לבן מעיל
Ketogenesis נוצר על ידי גופים קטון דרך התמוטטות של חומצות שומן וחומצות אמינו ketogenic. תהליך ביוכימי זה מספק אנרגיה לאיברים שונים, במיוחד למוח, בנסיבות של צום כתגובה לאי זמינות של גלוקוז בדם. גופי Ketone מיוצרים בעיקר במיטוכונדריה של תאי הכבד. בעוד תאים אחרים מסוגלים לבצע ketogenesis, הם לא יעילים כמו בתאי הכבד. מכיוון שקטוגנזה מתרחשת במיטוכונדריה, התהליכים שלה מוסדרים באופן עצמאי. ד"ר אלכס Jimenez DC, תובנה CCST

יישום טיפולי של דיאטה קטוגנית וגופי קטון אקסוגניים

היישומים של דיאטות קטוגניות וגופי קטון ככלי טיפולי התעוררו גם בהקשרים לא סרטניים כולל השמנת יתר ו- NAFLD / NASH (Browning et al., 2011; Foster et al., 2010; Schugar and Crawford, 2012); אי ספיקת לב (Huynh, 2016; Kolwicz et al., 2016; Taegtmeyer, 2016); מחלה נוירולוגית וניוונית (Martin et al., 2016; McNally and Hartman, 2012; Rho, 2015; Rogawski et al., 2016; Yang and Cheng, 2010; Yao et al., 2011); טעויות מולדות של מטבוליזם (Scholl-Bourggi et al, 2015); וביצועי פעילות גופנית (Cox et al., 2016). היעילות של דיאטות קטוגניות הוערכה במיוחד בטיפול בהתקפים אפילפטיים, במיוחד בקרב חולים עמידים לתרופות. מרבית המחקרים העריכו דיאטות קטוגניות בחולי ילדים, וחשפו ירידה של עד ~ 50% בתדירות ההתקפים לאחר 3 חודשים, עם יעילות משופרת בתסמונות נבחרות (Wu et al., 2016b). הניסיון מוגבל יותר באפילפסיה של מבוגרים, אך ניכרת ירידה דומה, עם תגובה טובה יותר בחולי אפילפסיה כללית סימפטומטית (Nei et al., 2014). המנגנונים האנטי פרכסיים הבסיסיים נותרים לא ברורים, אם כי השערות מבוססות כוללות שימוש מופחת / גליקוליזה של גלוקוזה, הובלת גלוטמט מתוכנת מחדש, השפעה עקיפה על תעלת אשלגן רגישה ל- ATP או על קולטן אדנוזין A1, שינוי ביטוי איזופורמי של ערוץ הנתרן, או השפעות על הורמונים במחזור כולל לפטין ( Lambrechts et al., 2016; Lin et al., 2017; Lutas and Yellen, 2013). עדיין לא ברור אם ההשפעה האנטי פרכוסית מיוחסת בעיקר לגופי קטון, או בגלל ההשלכות המטבוליות המפלות של דיאטות דלות בפחמימות. עם זאת, נראה כי אסטרים של קטונים (ראה להלן) מעלים את סף ההתקפים במודלים של בעלי חיים של התקפים מעוררים (Ciarlone et al., 2016; D'Agostino et al., 2013; Viggiano et al., 2015).

דיאטות פחמימות נמוכות וקטוגניות, לעיתים קרובות נחשבות לא נעימות, ועשויות לגרום לעצירות, היפר-ריאקמיה, היפוקלוקמיה, היפומגנסמיה, להוביל לנפרוליטיאזיס, לקטואסידוזיס, לגרום היפרגליקמיה, ולהעלות את כולסטרול הדם ואת ריכוז חומצות השומן החופשי (Bisschop et al., 2001 קוסוב והרטמן, 2012, Kwiterovich ואחרים, 2003, סוזוקי ואח ', 2002). מסיבות אלה, דבקות ארוכת טווח מציבה אתגרים. מחקרים מכרסמים בדרך כלל משתמשים בהפצה ייחודית של מקרונוטריינטים (94% שומן קק"ל, 1% פחמימות פחמימות, 5% חלבון קק"ל, Bio-Serv F3666), מה שמעורר קטוזיס חזק. עם זאת, הגדלת תכולת החלבון, אפילו ל- 10% קק"ל מפחית באופן משמעותי את ketosis, ו 5% הגבלת חלבון קקאל מעניק מבלבל השפעות מטבוליות ופיזיולוגיות. ניסוח דיאטה זה הוא גם מדולדל כולין, משתנה נוסף המשפיע על רגישות לפגיעה בכבד, ואפילו קטוגנזה (Garbow et al, 2011, Jornayvaz ואח ', 2010, קנדי ​​ואח', 2007, פיסיוס ואח ', 2013; Schugar et al., 2013). ההשפעות של צריכה ארוכת טווח של דיאטות ketogenic בעכברים להישאר מוגדרים חלקית, אך מחקרים שנעשו לאחרונה עכברים חשף הישרדות נורמלי היעדר של סמני פגיעה בכבד בעכברים על דיאטות ketogenic על תוחלת החיים שלהם, למרות מטבוליזם חומצות אמינו, הוצאות אנרגיה, ואת האינסולין איתות (Douris et al., 2015).

מנגנונים הגדלים קטוזיס באמצעות מנגנונים חלופיים דיאטות ketogenic כוללים את השימוש מבשרי בגוף קטון. מינון של גופי קטון אקסוגניים יכול ליצור מצב פיזיולוגי ייחודי לא נתקל בפיזיולוגיה נורמלי, כי מחזורי גלוקוז וריכוזי אינסולין הם נורמליים יחסית, בעוד תאים עשויים לחסוך ספיגה וניצול גלוקוז. לגופי הקטון עצמם מחצית חיים קצרים, ובליעה או עירוי של נתרן? מלח OHB להשגת קטוזיס טיפולי מעורר עומס נתרן לא רע. R / S-1,3-butanediol הוא דיאלכוהול לא רעיל שמתחמצן בקלות בכבד כדי להניב d / l-? OHB (Desrochers et al., 1992). בהקשרים ניסיוניים מובהקים, מנה זו ניתנה מדי יום לעכברים או לחולדות במשך שבעה שבועות, והניבה ריכוזי OHB במחזור של עד 5 מ"מ בתוך שעתיים מהניהול, שהיא יציבה לפחות 2 שעות נוספות (D ' אגוסטינו ואח ', 3). דיכוי חלקי של צריכת מזון נצפתה מכרסמים נתון R / S-1,3-butanediol (נגר וגרוסמן, 1983). בנוסף, שלושה אסטרי קטונים מובחנים כימית (KE), (i) מונואסטר של R-1,3-בוטנידיול ו- d-? OHB (R-3-hydroxybutyl R-? OHB); (ii) גליצריל-טריס- OHB; ו- (iii) R, S-1,3-butanediol acetoacetate diester, נחקרו בהרחבה (Brunengraber, 1997; Clarke et al., 2012a; Clarke et al., 2012b; Desrochers et al., 1995a; Desrochers et al. ., 1995b; Kashiwaya et al., 2010). יתרון מובנה של הקודם הוא ש -2 שומות של d-? OHB מיוצרות למול KE, בעקבות הידרוליזה של אסטראז במעי או בכבד. בטיחות, פרמקוקינטיקה וסובלנות נחקרו באופן נרחב ביותר בבני אדם שנטלו R-3-hydroxybutyl R-? OHB, במינונים של עד 714 מ"ג / ק"ג, והניבו ריכוזי d-? OHB במחזור של עד 6 מ"מ (Clarke et al., 2012a; Cox et al., 2016; Kemper et al., 2015; Shivva et al., 2016). במכרסמים, KE זה מקטין את צריכת הקלוריות ואת הכולסטרול הכולל של הפלזמה, מגרה רקמת שומן חומה ומשפר את עמידות האינסולין (Kashiwaya et al., 2010, Kemper et al., 2015, Veech, 2013). ממצאים אחרונים מצביעים על כך שבמהלך פעילות גופנית אצל ספורטאים מאומנים, בליעת R-3-hydroxybutyl R-? OHB הפחיתה את גליקוליזת שרירי השלד ואת ריכוזי הלקטט בפלזמה, הגדילה את חמצון הטריאציל-גליצרול תוך שריר ושמרה על תכולת הגליקוגן בשרירים, גם כאשר הפחמימה שנבלעה יחד גירתה הפרשת אינסולין ( קוקס ואח ', 2016). פיתוח נוסף של תוצאות מסקרנות אלה נדרש, שכן השיפור בביצועי פעילות הסיבולת הונע בעיקר על ידי תגובה חזקה ל- KE במקצועות 2 / 8. יחד עם זאת, תוצאות אלו תומכות במחקרים קלאסיים המצביעים על העדפת תחמוצת קטון על פני מצעים אחרים (GARLAND et al, 1962, Hasslbaink ואח ', 2003, סטנלי ואח', 2003, Valente-Silva ואח ', 2015) כולל במהלך פעילות גופנית, וכי ספורטאים מאומנים עשויים להיות מיומנים יותר לשימוש בקטונים (ג'ונסון ואחרים, 1969a, ג'ונסון ווולטון, 1972, Winder et al, 1974, Winder et al, 1975). לבסוף, המנגנונים שעשויים לתמוך בביצועים מימוש משופרים בעקבות צריכת קלוריות שווה (מופץ באופן דיפרנציאלי בין מקרו-חומרי) ושיעורי צריכת חמצן שווים יישארו.

מבט לעתיד

לאחר שסטיגמה ברובם כנתיב הצפה המסוגל לצבור פליטות רעילות בעירת שומן במצבים מוגבלים של פחמימות (הפרדיגמה ה"קטוטוקסית "), התצפיות האחרונות תומכות ברעיון שחילוף החומרים בגוף הקטון משרת תפקידים מקדמים גם במצבים עמוסי פחמימות, ופותח" קטוהורמטית ". השערה. הגישות התזונתיות והפרמקולוגיות הקלות על מניפולציה של חילוף החומרים של הקטונים הופכות אותו למטרה טיפולית אטרקטיבית, אך במעבדות המחקר הבסיסיות ובתרגום נותרו ניסויים אגרסיביים אך זהירים. צרכים שלא סיפקו הופיעו בתחומי הגדרת התפקיד של מינוף חילוף החומרים של הקטון באי ספיקת לב, השמנת יתר, NAFLD / NASH, סוכרת מסוג 2 וסרטן. ההיקף וההשפעה של תפקידי איתות 'לא קנוניים' של גופי קטון, כולל ויסות כספומטים העשויים להאכיל ולהתקדם למסלולי חילוף החומרים והסימנים, מחייבים בדיקה מעמיקה יותר. לבסוף, קטוגנזה מחוץ לכבד יכולה לפתוח מנגנוני איתות פראקריניים ואוטוקריניים מסקרנים והזדמנויות להשפיע על חילוף חומרים משותף במערכת העצבים ובגידולים להשגת מטרות טיפוליות.

תודות

Ncbi.nlm.nih.gov/pmc/articles/PMC5313038/

הערות שוליים

Ncbi.nlm.nih.gov

לסיכום, גופי קטון נוצרים על ידי הכבד על מנת לשמש כמקור אנרגיה כאשר אין מספיק גלוקוז זמין בגוף האדם. קטוגנזה מתרחשת כאשר יש רמות גלוקוז נמוכות בדם, במיוחד לאחר שמוצו מאגרי פחמימות תאיים אחרים. מטרת המאמר לעיל הייתה לדון בתפקידים הרב ממדיים של גופי קטון בחילוף החומרים בדלק, איתות וטיפול. היקף המידע שלנו מוגבל לבעיות בריאות כירופרקטיקה ובעמוד השדרה. כדי לדון בנושא, אל תהסס לשאול את ד"ר חימנז או ליצור איתנו קשר ב 915-850-0900 .

אושר על ידי ד"ר אלכס Jimenez

הפניה ל:Ncbi.nlm.nih.gov/pmc/articles/PMC5313038/

לחצן התקשרות הירוק H. PNG

דיון בנושא נוסף: "כאבי גב חריפים

כאב גבזהו אחד הגורמים השכיחים ביותר לנכות וימי החמצה בעבודה ברחבי העולם. כאבי גב מייחסים את הסיבה השנייה בשכיחותה לביקורים במשרדי רופאים, שנמצאים במספרם רק בזיהומים בדרכי הנשימה העליונות. כ- 80 אחוז מהאוכלוסייה יחוו כאבי גב לפחות פעם אחת במהלך חייהם. עמוד השדרה הוא מבנה מורכב המורכב מעצמות, מפרקים, רצועות ושרירים, בין רקמות רכות אחרות. פציעות ו / או תנאים מחמירים, כגון דיסקים, יכול בסופו של דבר להוביל לסימפטומים של כאבי גב. פציעות ספורט או פגיעות בתאונות דרכים הן לעיתים קרובות הגורם השכיח ביותר לכאבי גב, אולם לפעמים התנועות הפשוטות ביותר יכולות לגרום לתוצאות כואבות. למרבה המזל, אפשרויות טיפול אלטרנטיביות, כמו טיפול כירופרקטי, יכולות לעזור להקל על כאבי גב באמצעות התאמות בעמוד השדרה ומניפולציות ידניות, ובסופו של דבר לשפר את הקלה בכאב.

תמונה של הילד קריקטורה

EXTRA EXTRA | חשוב נושא: מומלץ אל Paso, TX Chiropractor

***

מה הם הסיכונים של Nrf2 Overexpression?

מה הם הסיכונים של Nrf2 Overexpression?

אל האני גרעיני erythroid 2 גורם הקשורים 2 איתות המסלול, הידוע בעיקר בכינוי Nrf2, הוא מנגנון מגן המתפקד כ"מווסת ראשי "של תגובת נוגדי החמצון בגוף האדם. Nrf2 מרגיש את רמות הלחץ החמצוני בתוך התאים ומפעיל מנגנוני נוגדי חמצון מגנים. אמנם להפעלת Nrf2 יכולות להיות יתרונות רבים, אך ל- "ביטוי יתר" ל- Nrf2 עלולים להיות כמה סיכונים. נראה כי דרגה מאוזנת של NRF2 חיונית למניעת התפתחות כוללת של מגוון מחלות בנוסף לשיפור הכללי של בעיות בריאותיות אלה. עם זאת, NRF2 יכול גם לגרום לסיבוכים. הסיבה העיקרית מאחורי "ביטוי יתר" של NRF2 נובעת בין היתר ממוטציה גנטית או מחשיפה כרונית מתמשכת לסטרס כימי או חמצוני. להלן נדון בחסרונות של ביטוי יתר של Nrf2 ונדגים את מנגנוני הפעולה שלו בגוף האדם.

מחלת הסרטן

מחקרים הראו כי עכברים שאינם מבטאים NRF2 נוטים יותר לפתח סרטן בתגובה לגירוי פיזי וכימי. מחקרים דומים, עם זאת, הראו כי הפעלת יתר של NRF2, או אפילו הפעלת KEAP1, עלולה לגרום להחמרה של סוגי סרטן מסוימים, במיוחד אם מסלולים אלה הופרעו. יתר על המידה NRF2 יכול להתרחש באמצעות עישון, כאשר האמונה בהפעלה מתמשכת של NRF2 היא הגורם לסרטן ריאות אצל מעשנים. ביטוי יתר של Nrf2 עלול לגרום לתאים סרטניים שלא להשמיד את עצמם, בעוד הפעלת NRF2 לסירוגין יכולה למנוע מתאים סרטניים להפעיל השראת רעלים. בנוסף, מכיוון שביטוי יתר של NRF2 מגביר את יכולתו של נוגדי חמצון בגוף האדם לתפקד מעבר להומאוסטזיס החמצון, הדבר מגביר את חלוקת התאים ויוצר דפוס לא טבעי של מתילציה של DNA והיסטון. בסופו של דבר זה יכול להפוך כימותרפיה ורדיותרפיה ליעילים פחות נגד סרטן. לכן, הגבלת הפעלת NRF2 עם חומרים כמו DIM, Luteolin, Zi Cao או salinomycin עשויה להיות אידיאלית לחולים בסרטן, אם כי אין לראות בהפעלת יתר Nrf2 כגורם היחיד לסרטן. ליקויים בחומרים תזונתיים יכולים להשפיע על גנים, כולל NRF2. זו עשויה להיות דרך אחת כיצד ליקויים תורמים לגידולים.

כבד

Overactivation של Nrf2, יכול להשפיע גם על תפקודם של איברים ספציפיים בגוף האדם. NRF2 overexpression יכול בסופו של דבר לחסום את הייצור של אינסולין כמו גורם הצמיחה 1, או IGF-1, מהכבד, שהוא חיוני עבור התחדשות של הכבד.

לֵב

בעוד overexpression חריפה של Nrf2 עשויים להיות היתרונות שלה, overexpression מתמשך של NRF2 עלול לגרום לטווח ארוך השפעות מזיקות על הלב, כגון cardiomyopathy. ביטוי NRF2 יכול להיות מוגבר באמצעות רמות גבוהות של כולסטרול, או את ההפעלה של HO-1. זה האמין להיות הסיבה מדוע רמות גבוהות של כולסטרול כרונית עלולה לגרום לבעיות לב וכלי דם.

ויטיליגו

NRF2 overexpression הוכח גם כדי לעכב את היכולת repigment ב vitiligo כפי שהוא עלול לחסום Tyrosinase, או TYR, פעולה שהיא חיונית עבור repigmentation באמצעות melaninogenesis. מחקרים הראו כי תהליך זה עשוי להיות אחת הסיבות העיקריות מדוע אנשים עם ויטיליגו לא נראה להפעיל Nrf2 ביעילות כמו אנשים ללא ויטיליגו.

למה NRF2 מאי לא פונקציה כראוי

הורמזה

NRF2 צריך להיות מופעל הורמטית כדי להיות מסוגל לנצל את היתרונות שלו. במילים אחרות, Nrf2 לא אמור להפעיל כל דקה או כל יום, לכן, זה רעיון מצוין לקחת ממנו הפסקות, למשל, 5 ימים בחמישה ימי חופש או כל יום אחר. NRF5 חייב גם להשיג סף ספציפי כדי להפעיל את התגובה ההורמונית שלו, כאשר לחץ קטן לא יכול להיות מספיק כדי להפעיל אותו.

DJ-1 חמצון

חלבון deglycase DJ-1, או רק DJ-1, המכונה גם חלבון מחלת פרקינסון, או PARK7, הוא מווסת וגלאי ראשי למצב החמצון בגוף האדם. DJ-1 חיוני לקראת ויסות כמה זמן NRF2 יכול לבצע את תפקידו ולייצר תגובה נוגדת חמצון. במקרה ש- DJ-1 מתחמצן יתר על המידה, התאים יהפכו את החלבון DJ-1 לנגיש פחות. תהליך זה גורם לפעולה של NRF2 לפוג מהר מדי, מכיוון ש- DJ-1 הוא בעל חשיבות עליונה לשמירה על רמות מאוזנות של NRF2 ולמנוע מהם להישבר בתא. במקרה של חלבון DJ-1 הוא לא קיים או overoxidized, הביטוי NRF2 יהיה כנראה מינימלי, אפילו באמצעות DIM או חלופה NRF2 activators. הביטוי DJ-1 הוא הכרחי כדי לשחזר פגום פעולה NRF2.

מחלה כרונית

אם יש לך מחלה כרונית, כולל CIRS, זיהומים כרוניים / דיסביוזה / SIBO, או הצטברות של מתכות כבדות, כגון כספית ו / או תעלות שורש, אלה יכולים לחסום את מערכות ה- NRF2 ולנקות רעלים בשלב השני. במקום שמתח חמצוני הופך את NRF2 לנוגד חמצון, NRF2 לא יניע וסטרס חמצוני יכול להישאר בתא ולגרום נזק, כלומר אין תגובה נוגדת חמצון. זו סיבה משמעותית מדוע לאנשים רבים עם CIRS יש כמה רגישויות ומגיעים לגורמים רבים. יש אנשים שמאמינים שהם עשויים להיות בעלי תגובת הרקס, אולם תגובה זו עלולה לפגוע רק בתאים רחוקים יותר. טיפול במחלות כרוניות, לעומת זאת, יאפשר לכבד לפרוק רעלים למרה, ולפתח בהדרגה את התגובה ההורמטית של הפעלת NRF2. אם המרה נותרה רעילה והיא לא מופרשת מגוף האדם, היא תפעיל מחדש את הלחץ החמצוני של NRF2 ויגרום לך להרגיש רע יותר לאחר שתספג מחדש מהמערכת העיכול או מעי העיכול. לדוגמא, אוצרטוקסין A עשוי לחסום את NRF2. מלבד הטיפול בבעיה, מעכבי deacetylase של היסטון יכולים לחסום את התגובה החמצונית ממספר הגורמים המפעילים הפעלת NRF2 אך זה עשוי גם למנוע מ- NRF2 להופיע באופן נורמלי, מה שעלול בסופו של דבר לא לשרת את מטרתו.

דיסרגולציה של שמן דגים

Cholinergics הם חומרים אשר להגביר אצטילכולין, או ACH, ו choline במוח באמצעות עלייה של ACH, במיוחד כאשר inhibiting התמוטטות של ACH. חולים עם CIRS לעיתים קרובות יש בעיות עם dysregulation של רמות אצטילכולין בגוף האדם, במיוחד במוח. שמן דגים מפעילה NRF2, הפעלת מנגנון נוגד חמצון מגן בתוך התאים. אנשים הסובלים ממחלות כרוניות עלולים לסבול מבעיות קוגניטיביות ואקסיטוטוקסיות של אצטילכולין, מהצטברות אורגנו-פוספטים, העלולים לגרום לשמן דגים ליצור דלקת בגוף האדם. מחסור בכולין גורם בנוסף להפעלת NRF2. הכללת כולין בתזונה שלך (פוליפנולים, ביצים וכו ') יכולה לסייע בהגברת ההשפעות של ויסות כולינרגי.

מה מפחית NRF2?

הקטנת NPR2 overexpression הוא הטוב ביותר עבור אנשים שיש להם סרטן, למרות שזה עשוי להיות מועיל עבור מגוון רחב של בעיות בריאותיות אחרות.

דיאטה, תוספי תזונה ותרופות שכיחות:

  • אפיגנין (מינון גבוה יותר)
  • ברוסה ג'אווניקה
  • עַרמוֹנִים
  • EGCG (מינונים גבוהים מגדילים את NRF2)
  • חילבה (טריגונלין)
  • Hiba (Hinokitiol /? -Thujaplicin)
  • דיאט מלח גבוהה
  • לוטולין (סלרי, פלפל ירוק, פטרוזיליה, עלה פרילה ותה קמומיל - מינונים גבוהים יותר עשויים להגדיל את NRF2 - 40 mg / kg luteolin שלוש פעמים בשבוע)
  • Metformin (הכנסה כרונית)
  • N-Acetyl-L-Cysteine ​​(NAC, על ידי חסימת התגובה החמצונית, SP במינונים גבוהים)
  • תפוז קליפה (יש פלבנואידים polymethoxylated)
  • Quercetin (מינונים גבוהים יותר עשויים להגדיל את NRF2 - 50 mg / kg / d quercetin)
  • סלינומיצין (סמים)
  • רטינול (כל חומצה רטינואית)
  • ויטמין C בשילוב עם Quercetin
  • Zi Cao (Gromwel סגול יש Shikonin / Alkannin)

שבילים ואחרים:

  • Bach1
  • לְהַמֵר
  • ביופילמים
  • ברוסטול
  • Camptothecin
  • DNMT
  • DPP-23
  • EZH2
  • Glucocorticoid איתות קולטן (Dexamethasone ו Betamethasone גם כן)
  • GSK-3? (משוב רגולטורי)
  • הפעלת HDAC?
  • Halofuginone
  • הומוציסטאין (ALCAR יכול להפוך את ההומוציסטאין הזה לרמות נמוכות של NRF2)
  • IL-24
  • Keap1
  • MDA-7
  • NF? B
  • Ochratoxin A (אספרגילוס ומינים pencicllium)
  • חלבון לוקמיה פרומיאלוציטי
  • p38
  • p53
  • p97
  • קולטן חומצה רטינואית אלפא
  • סלניט
  • SYVN1 (Hrd1)
  • STAT3 עיכוב (כגון Cryptotanshinone)
  • טסטוסטרון (ו טסטוסטרון propionate, למרות TP אינטראנסאלי עשוי להגדיל NRF2)
  • Trecator (Ethionamide)
  • Trx1 (באמצעות הפחתה של Cys151 ב Keap1 או של Cys506 באזור NLS של Nrf2)
  • טרולוקס
  • וורינוסטאט
  • מחסור אבץ (עושה את זה יותר גרוע במוח)

מנגנון פעולה של Nrf2

מתח חמצוני מעורר באמצעות CUL3 שבו NRF2 מ- KEAP1, מעכב שלילי, נכנס לאחר מכן לגרעין של תאים אלה, וממריץ את תמליל ה- AREs, הופך את הגופרית לדיסולפידים, והופך אותם לגנים נוגדי חמצון רבים יותר, מה שמוביל לעלייה בחומרים נוגדי חמצון, כמו GSH, GPX, GST, SOD, וכו '. שאר אלה ניתן לראות ברשימה להלן:
  • מגביר AKR
  • גדל ARE
  • מגביר ATF4
  • מגביר Bcl-xL
  • מגדיל את Bcl-2
  • מגביר את BDNF
  • מגדילה את BRCA1
  • מגדילה c-Jun
  • מגדילה את CAT
  • מגדילה cGMP
  • מגדיל CKIP-1
  • מגדילה את CYP450
  • מגדילה את Cul3
  • מגדיל את ה- GCL
  • מגביר GCLC
  • מגדיל את ה- GCLM
  • מגביר את ה- GCS
  • מגביר GPX
  • הגדלת GR
  • מגביר את GSH
  • מגדיל את ה- GST
  • מגדיל HIF1
  • מגדילה את HO-1
  • מגדיל HQO1
  • מגביר HSP70
  • מגדיל את IL-4
  • מגדיל את IL-5
  • מגדיל את IL-10
  • מגדיל את IL-13
  • מגדיל K6
  • מגדיל K16
  • מגדיל K17
  • מגדילה mEH
  • מגדילה את Mrp2-5
  • מגביר NADPH
  • מגביר את חריץ 1
  • מגדילה את NQO1
  • מגביר PPAR-alpha
  • מגביר Prx
  • מגדילה את p62
  • מגדילה את Ssn2
  • מגביר את Slco1b2
  • מגדילה sMafs
  • מגביר את SOD
  • מגביר Trx
  • מגביר Txn (ד)
  • הגדלת UGT1 (A1 / 6)
  • מגדילה את VEGF
  • צמצום ADAMTS (4 / 5)
  • הפחתת אלפא-סמא
  • צמצום ALT
  • צמצום AP1
  • צמצום AST
  • צמצום Bach1
  • מפחית את COX-2
  • צמצום DNMT
  • הפחתת FASN
  • הפחתת FGF
  • הפחתת HDAC
  • מפחית את IFN-?
  • הפחתת IgE
  • מפחית את IGF-1
  • מפחית את IL-1b
  • מפחית את IL-2
  • מפחית את IL-6
  • מפחית את IL-8
  • מפחית את IL-25
  • מפחית את IL-33
  • הפחתת iNOS
  • מפחית LT
  • מפחית את Keap1
  • צמצום MCP-1
  • מקטין את MIP-2
  • צמצום MMP-1
  • צמצום MMP-2
  • צמצום MMP-3
  • צמצום MMP-9
  • צמצום MMP-13
  • מקטין את NfkB
  • צמצום NO
  • מקטין את SIRT1
  • הפחתת TGF-b1
  • הפחתת TNF-Alpha
  • הפחתת טיר
  • הפחתת VCAM-1
  • מקודד מתוך הגן NFE2L2, NRF2, או גורם גרעיני 2 הקשור ל- 2 של XNUMX, הוא גורם שעתוק ברוכסן הליוצין הבסיסי, או bZIP, superfamily אשר מנצל מבנה Cap'n'Collar או CNC.
  • הוא מקדם אנזימים חנקתיים, אנזימים ביו-טרנספורמציה, ומובילי זרימה קסנוביוטים.
  • זהו מווסת חיוני בהשראת גנים אנזימים נוגדי חמצון שלב II וניקוי רעלים, המגנים על התאים מפני נזק הנגרם על ידי סטרס חמצוני והתקפות אלקטרופיליות.
  • במהלך תנאים הומיאוסטטיים, Nrf2 הוא מרותק בציטוזול באמצעות התקשרות גופנית של N- מסוף מושלם של Nrf2, או כמו Kelch כמו ECH הקשורים חלבון או Keap1, המכונה גם INrf2 או מעכב של Nrf2, מעכבת הפעלה Nrf2.
  • זה גם יכול להיות נשלט על ידי יונקים selenoprotein thioredoxin רדוקטאז 1, או TrxR1, אשר פועל כווסת שלילי.
  • על הפגיעות כדי stressorsilic stressors, Nrf2 disociates מ Keap1, translocating לתוך הגרעין, שם הוא heterodimerizes מכן עם מגוון של חלבון הרגולציה תעתיק.
  • אינטראקציות תכופות מורכבות עם אלה של רשויות שעתוק יוני ופוס, אשר יכול להיות חברים של חלבון activator חלבון של גורמי שעתוק.
  • לאחר dimerization, מתחמים אלה ואז להיקשר רכיבים נוגדי חמצון / electrophile תגובה ARE / EPRE ולהפעיל שעתוק, כפי שקורה עם קומפלקס Jun-Nrf2, או לדכא שעתוק, בדומה למתחם Fos-Nrf2.
  • המיקום של ARE, אשר מופעלת או מעוכבת, יקבע אילו גנים נשלטים על ידי משתנים אלה.
  • כאשר מופעלת ARE:
  1. הפעלת הסינתזה של נוגדי חמצון מסוגלת לטהר רעלים כמו קטלאז, סופר -וקסיד-דיסמוטאז, או SOD, GSH- פרוקסידאזים, GSH-reductase, GSH-transferase, NADPH-quinone oxidoreductase, או NQO1, Cytochrome P450 monooxygenase, thioredoxin, thiored רדוקטאז ו- HSP70.
  2. הפעלה של סינתז GSH זה מאפשרת צמיחה ניכרת של התואר ה- GSH התוך, וזה מגן למדי.
  3. הגדלת סינתזה זו מעלות של אנזימים שלב II כמו UDP-glucuronosyltransferase, N-acetyltransferases, ו sulfotransferases.
  4. Upregulation של HO-1, שהוא קולטן מגן באמת עם צמיחה פוטנציאלית של CO זה בשילוב עם NO מאפשר vasodilation של תאים איסכמיים.
  5. הפחתת עומס הברזל באמצעות ferritin מוגבר bilirubin כמו נוגד חמצון lipophilic. שני חלבונים שלב II יחד עם נוגדי חמצון מסוגלים לתקן את הלחץ החמצוני הכרוני וגם להחיות מערכת החזר תקין.
  • GSK3? בניהול AKT ו- PI3K, זרחן Fyn וכתוצאה מכך לוקליזציה גרעינית Fyn, אשר Fyn זרחן Nrf2Y568 המוביל לייצוא גרעיני ולהשפלה של Nrf2.
  • NRF2 גם dampens TH1 / TH17 התגובה ומעשיר את התגובה TH2.
  • מעכבי HDAC הפעילו את נתיב האיתות של Nrf2 והורדו למעלה, שמטרות הנחיתה Nrf2 HO-1, NQO1 ו- glutamate-cysteine ​​ligase קטליטי משנה, או GCLC, על ידי ריסון Keap1 ועידוד ניתוק של Keap1 מ- Nrf2, Nrf2 טרנסלוקציה גרעינית ו- Nrf2 -כריכה.
  • Nrf2 כולל מחצית חיים של כ 20 דקות בתנאים הבסיסיים.
  • הפחתת ה- IKK? בריכה באמצעות כריכת Keap1 מפחיתה את I? B? השפלה ועשוי להיות המנגנון החמקמק לפיו הוכח כי הפעלת Nrf2 מעכבת הפעלת NF? B.
  • Keap1 לא תמיד צריך להיות downregulated כדי לקבל NRF2 לפעול, כגון chlorophyllin, אוכמניות, חומצה אלגית, astaxanthin, פוליפנולים תה עשוי להגביר NRF2 ו KEAP1 ב 400 אחוזים.
  • Nrf2 מסדיר שלילי באמצעות המונח staturoyl Co desaturase, או SCD, ו litase ציטראט, או CL.

גנטיקה

KEAP1

rs1048290

  • אלל C - הראה סיכון משמעותי עבור ו אפקט מגן מפני נגד אפילפסיה עמידות (DRE)

rsXNXX (אני AC)

  • הקשורים עם שיעור הירידה של תפקוד הריאות LHS

MAPT

rs242561

  • אלל T - אלל מגן להפרעות פרקינסון - היה חזק יותר ב- NRF2 / sMAF, והיה קשור לרמות ה- MRNA הגבוהות יותר ב- MNT באזורים שונים של המוח, כולל cereex cereex (CRBL), קליפת המוח הטמפורלית (TCTX), החומר הלבן intralobular (WHMT)

NFE2L2 (NRF2)

rs10183914 (אני CT)

  • אלל T - רמות גבוהות של חלבון Nrf2 ועידן מושהה של התפרצות פרקינסון בארבע שנים

rsXNXX (אני AC)

  • אלל C - היו בסיכון גבוה יותר למחלת פרקינסון

rs1806649 (אני CT)

  • אלל C - זוהה ועשוי להיות רלוונטי לאטיולוגיה של סרטן השד.
  • הקשורים בסיכון מוגבר לאשפוזים בבתי החולים בתקופות של רמות PM10 גבוהות

rs1962142 (אני GG)

  • אלל T - היה קשור לרמה נמוכה של ביטוי NRF2 cytoplasmic (P = 0.036) וביטוי sulfiredoxin שלילי (P = 0.042)
  • אלל - מוגן מפני ירידה בזרימת הדם (FEV) ירידה (נפח כפוי מאולץ בשנייה אחת) ביחס למצב עישון סיגריות (p = 0.004)

rs2001350 (אני TT)

  • אלל T מוגן מפני ירידה ב- FEV (נפח כפוי מאולץ בשנייה אחת) ביחס למצב עישון סיגריות (p = 0.004)

rs2364722 (אני AA)

  • Allele - מוגן מפני הירידה FEV (נפח כפוי בכפייה בשנייה אחת) ביחס למצב עישון סיגריה (p = 0.004)

rs2364723

  • C אלל - קשור עם FEV מופחת באופן משמעותי מעשנים יפנים עם סרטן ריאות

rs2706110

  • אלל G - הראה סיכון משמעותי עבור אפקט מגן מפני אפילפסיה עמידות לסמים (DRE)
  • אללים AA - הראו באופן משמעותי ביטוי KEAP1
  • אללים AA - היה קשור בסיכון מוגבר לסרטן השד (P = 0.011)

rs2886161 (אני TT)

  • אלל T - קשור למחלת פרקינסון

rs2886162

  • אלל - נקשר לביטוי NRF2 נמוך (P = 0.011; OR, 1.988; CI, 1.162 3.400) וגנוטיפ AA נקשר בהישרדות גרועה יותר (P = 0.032; HR, 1.687; CI, 1.047 2.748)

rs35652124 (אני TT)

  • אלל - קשור עם גבוה יותר הקשורים בגיל בתחילת המחלה פרקינסון לעומת אלל G
  • אלל C - גדל חלבון NRF2
  • אלל T - היה פחות חלבון NRF2 וסיכון גבוה יותר למחלות לב וללחץ דם

rs6706649 (אני CC)

  • אלל C - היה נמוך יותר NRF2 חלבון ולהגדיל את הסיכון למחלת פרקינסון

rs6721961 (אני GG)

  • T אלל - היה נמוך יותר NRF2 חלבון
  • אללים TT - הקשר בין עישון סיגריות במעשנים כבדים וירידה באיכות הזרע
  • אלל TT - היה קשור לסיכון מוגבר לסרטן השד [P = 0.008; או, 4.656; רווח בר סמך (CI), 1.350 16.063] ואלל T נקשר במידה נמוכה של ביטוי חלבון NRF2 (P = 0.0003; OR, 2.420; CI, 1.491 3.926) וביטוי SRXN1 שלילי (P = 0.047; OR, 1.867; CI = 1.002 3.478)
  • אלל T - אלל היה קשור גם עם תמותת ה- 28 ביום הקשור ל- ALI בעקבות תסמונת תגובה דלקתית מערכתית
  • אלל T מוגן מפני ירידה ב- FEV (נפח כפוי מאולץ בשנייה אחת) ביחס למצב עישון סיגריות (p = 0.004)
  • אלל G - קשור בסיכון מוגבר ל- ALI בעקבות טראומה גדולה בקרב אירופאים ואמריקנים אפריקאים (יחס סיכויים, או 6.44, רווח 95%
  • אללים של אלצהיימר - הקשורים לאסטמה הנגרמת כתוצאה מזיהום
  • אללים של אלצהיימר - הפחיתו באופן משמעותי את ביטוי הגנים של NRF2, וכתוצאה מכך סיכון מוגבר לסרטן הריאות, במיוחד אלו שעישנו אי פעם
  • אלל AA - היה בסיכון גבוה משמעותית לפתח T2DM (או 1.77, 95% CI 1.26, 2.49, p = 0.011) ביחס לאלו עם הגנוטיפ CC
  • אללים A - קשר חזק בין תיקון הפצע לבין רעילות מאוחר של קרינה (הקשורים בסיכון גבוה משמעותית לפתח השפעות מאוחרות אפריקאים אמריקאים עם מגמה הקווקזים)
  • הקשורים בטיפול באסטרוגן אוראלי וסיכון לתרומבואמבוליזם ורידי אצל נשים לאחר גיל המעבר

rs6726395 (אני AG)

  • Allele - מוגן מפני ירידה FEV1 (נפח כפוי בכפייה בשנייה אחת) ביחס למצב עישון סיגריות (p = 0.004)
  • אלל - קשור עם הפחתה משמעותית של FEV1 במעשנים יפנים עם סרטן ריאות
  • אללים GG - היו רמות NRF2 גבוהות יותר וסיכון מופחת לניוון מקולרי
  • אללים GG - היה הישרדות גבוהה יותר עם Cholangiocarcinoma

rs7557529 (אני CT)

  • אלל C - הקשור למחלת פרקינסון
ד"ר חימנז לבן מעיל
מתח חמצוני ו stressors אחרים יכולים לגרום נזק לתאים אשר עלול בסופו של דבר להוביל מגוון רחב של בעיות בריאות. מחקרים הוכיחו כי הפעלת Nrf2 יכול לקדם את מנגנון נוגד חמצון המגן של גוף האדם, אולם, חוקרים דנו כי ביטוי יתר Nrf2 יכול להיות סיכונים עצומים לקראת בריאות ואיכות חיים הכוללת. סוגים שונים של סרטן יכולים להתרחש גם עם Nrf2 overactivation. ד"ר אלכס Jimenez DC, תובנה CCST

Sulforaphane והשפעותיו על סרטן, תמותה, הזדקנות, מוח והתנהגות, מחלות לב ועוד

Isothiocyanates הם כמה תרכובות צמח החשוב ביותר שאתה יכול לקבל בתזונה. בסרטון זה אני עושה את המקרה המקיף ביותר עבור אותם כי היה אי פעם. טווח קשב קצר? דלג לנושא המועדף עליך על ידי לחיצה על אחת מנקודות הזמן הבאות. ציר זמן מלא להלן. מקטעי מפתח:
  • 00: 01 - סרטן ותמותה
  • 00: 19 - הזדקנות
  • 00: 26: 30 - המוח וההתנהגות
  • 00: 38 - סיכום סופי
  • 00: 40 - מינון
ציר זמן מלא:
  • 00: 00: 34 - מבוא של sulforaphane, מוקד עיקרי של הסרטון.
  • 00: 01: 14 - הצריכה של הצומח הצמח והפחתת בתמותה מכל הסיבות.
  • 00: 02 - סיכון לסרטן הערמונית.
  • 00: 02 - סיכון לסרטן שלפוחית ​​השתן.
  • 00: 02 - סרטן הריאה אצל מעשנים מסתכן.
  • 00: 02 - סיכון לסרטן השד.
  • 00: Hypothetical: מה אם כבר יש לך סרטן? (התערבות)
  • 00: 03: 35 - מנגנון מתקבל על הדעת המניע את הנתונים התמותה הסרטן ותמותה.
  • 00: 04 - Sulforaphane וסרטן.
  • 00: 05: 32 - ראיות לבעלי חיים המראים השפעה חזקה של ברוקולי לנבוט לחלץ על התפתחות שלפוחית ​​השתן בעכברים.
  • 00: 06 - השפעת תוסף ישיר של sulforaphane בחולי סרטן הערמונית.
  • 00: 07: 09 - ביואקומולציה של מטבוליטים איסוציאיאנט ברקמת השד בפועל.
  • 00: 08: 32 - עיכוב של תאי גזע סרטן השד.
  • 00: 08: 53 - שיעור היסטוריה: brassicas הוקמו כבעלי תכונות בריאותיות גם ברומא העתיקה.
  • 00: 09 - היכולת של Sulforaphane כדי לשפר את הפרשת מסרטן (בנזין, acrolein).
  • 00: 09 - NRF51 כמתג גנטי באמצעות רכיבי תגובה נוגדי חמצון.
  • 00: 10 - כיצד NRF10 ההפעלה משפר הפרשת מסרטן באמצעות גלוטתיון- S-conjugates.
  • 00: 10: 34 - נבטים בריסל להגדיל גלוטתיון- S-transferase ולהפחית נזק ל- DNA.
  • 00: 11 - ברוקולי לנבוט משקה מגביר הפרשת בנזין על ידי 20%.
  • 00: 13: 31 - ברוקולי לנבוט homogenate מגביר אנזימים נוגדי חמצון בדרכי הנשימה העליונות.
  • 00: 15: צריכת הצליבה הצמחית ותמותה ממחלות לב.
  • 00: 16 - ברוקולי נובט אבקת משפר את רמת השומנים בדם ואת הסיכון למחלות לב כל סוג של חולי סוכרת מסוג 55.
  • 00: 19 - תחילת סעיף ההזדקנות.
  • 00: 19 - דיאטה עשירה ב- Sulforaphane משפרת תוחלת חיים של חיפושיות מ- 21 ל- 15% (בתנאים מסוימים).
  • 00: 20 - חשיבותה של דלקת נמוכה לאריכות ימים.
  • 00: 22: CROCiferous ירקות ברוקולי נבט אבקה נראה להקטין מגוון רחב של סמנים דלקתיים בבני אדם.
  • 00: 23: 40 - סיכום וידאו: סרטן, קטעים מזדקנים
  • 00: 24: 14 - מחקרים שנעשו על ידי עכברים מצביעים על כך ש- sulforaphane עשוי לשפר את תפקוד המערכת החיסונית הזקנה בגיל מבוגר.
  • 00: 25 - שיפור צבע השיער גדל במודל עכבר של מקריח. תמונה ב 18: 00: 26.
  • 00: 26 - התחלה של המוח והתנהגות סעיף.
  • 00: 27: 18 - השפעת ברוקולי לנבוט לחלץ על אוטיזם.
  • 00: 27: 48 - השפעת glucoraphanin על סכיזופרניה.
  • 00: 28: 17 - תחילת הדיון בדיכאון (מנגנון ומחקרים סבירים).
  • 00: 31 - מחקר עכבר באמצעות 21 דגמים שונים של לחץ המושרה על-ידי דיכאון הראה sulforaphane ביעילות דומה כמו fluoxetine (prozac).
  • 00: 32: 00 - מחקר מראה בליעה ישירה של glucoraphanin בעכברים הוא יעיל באופן דומה במניעת דיכאון מ תבוסה חברתית מודל הלחץ.
  • 00: 33 - תחילתו של קטע neurodegeneration.
  • 00: 33 - Sulforaphane ואלצהיימר.
  • 00: 33 - Sulforaphane ומחלת פרקינסון.
  • 00: 33 - Sulforaphane והונגטינגטון.
  • 00: 34: 13 - Sulforaphane מגביר את החלבונים בהלם חום.
  • 00: 34 - תחילתו של סעיף פגיעה מוחית טראומטית.
  • 00: 35: 01 - Sulforaphane מוזרק מיד לאחר TBI משפר זיכרון (מחקר העכבר).
  • 00: 35: 55 - Sulforaphane ופלסטיות עצבית.
  • 00: 36: 32 - Sulforaphane משפר את הלמידה במודל של סוכרת מסוג II בעכברים.
  • 00: 37: 19 - Sulforaphane ו Duchenne ניוון שרירים.
  • 00: 37: עיכוב מיוסטטין בתאי לווין שרירים (במבחנה).
  • 00 - 38: 06: סיבת וידאו מאוחרת: תמותה וסרטן, נזק ל- DNA, מתח חמצוני ודלקת, הפרשת בנזן, מחלות לב וכלי דם, סוכרת מסוג II, השפעות על המוח (דיכאון, אוטיזם, סכיזופרניה, ניוון מוחי), נתיב NRF2.
  • 00: 40 - מחשבות על חישוב מנה של נבטי ברוקולי או sulforaphane.
  • 00: 41: אנקדוטות על הנבטה בבית.
  • 00: על טמפרטורת בישול ופעילות sulforaphane.
  • 00: 43: 45 - חיידקי הבטן המרה של sulforaphane מ glucoraphanin.
  • 00: 44 - תוספי מזון טובים יותר בשילוב עם מירוזינאז פעיל מירקות.
  • 00: 44 - טכניקות בישול וירקות cruciferous.
  • 00: 46 - Isothiocyanates כמו goitrogens.
על פי מחקרים, Nrf2, מהווה גורם שעתוק בסיסי המפעיל את מנגנוני נוגדי החמצון המגנים על התאים לניקוי רעלים מגוף האדם. ביטוי יתר של Nrf2, לעומת זאת, יכול לגרום לבעיות בריאותיות. היקף המידע שלנו מוגבל לבעיות בריאות כירופרקטיקה ובעמוד השדרה. כדי לדון בנושא, אל תהסס לשאול את ד"ר חימנז או ליצור איתנו קשר בכתובת 915-850-0900 . אושר על ידי ד"ר אלכס Jimenez
לחצן התקשרות הירוק H. PNG

דיון בנושא נוסף: "כאבי גב חריפים

כאב גבזהו אחד הגורמים השכיחים ביותר לנכות וימי החמצה בעבודה ברחבי העולם. כאבי גב מייחסים את הסיבה השנייה בשכיחותה לביקורים במשרדי רופאים, שנמצאים במספרם רק בזיהומים בדרכי הנשימה העליונות. כ- 80 אחוז מהאוכלוסייה יחוו כאבי גב לפחות פעם אחת במהלך חייהם. עמוד השדרה הוא מבנה מורכב המורכב מעצמות, מפרקים, רצועות ושרירים, בין רקמות רכות אחרות. פציעות ו / או תנאים מחמירים, כגון דיסקים, יכול בסופו של דבר להוביל תסמינים של כאבי גב. פציעות ספורט או פציעות תאונות דרכים הם לעתים קרובות הגורם השכיח ביותר של כאבי גב, עם זאת, לפעמים הפשוטה ביותר של תנועות יכול להיות תוצאות כואבות. למרבה המזל, אפשרויות טיפול אלטרנטיביות, כגון טיפול כירופרקטי, יכולות לעזור להקל על כאבי גב באמצעות שימוש בהתאמות השדרה ומניפולציות ידניות, ובסופו של דבר משפרות את תחושת הכאב.  
תמונה של הילד קריקטורה

EXTRA EXTRA | חשוב נושא: מומלץ אל Paso, TX Chiropractor

***
תפקידו של Nrf2 ההפעלה

תפקידו של Nrf2 ההפעלה

מחקרים עכשוויים רבים על סרטן אפשרו לבריאות אנשי מקצוע להבין את הדרך הגוף detoxes. על ידי ניתוח גנים upregulated בתאים סרטניים, החוקרים גילו את גרעיני erythroid 2 גורם הקשורים 2 איתות המסלול, הידועה ביותר בשם Nrf2. NRF2 הוא גורם שעתוק חשוב אשר מפעיל את הגוף האנושי מנגנוני הגנה נוגדי חמצון על מנת להסדיר חמצון משני גורמים חיצוניים ופנימיים כדי למנוע רמות מוגברות של מתח חמצוני.

עקרונות Nrf2

NRF2 חיוני לשמירה על הבריאות והבריאות הכללית מכיוון שהוא שומר על המטרה העיקרית לווסת כיצד אנו מנהלים את כל מה שאנו נחשפים אליו באופן יומיומי ולא נהיה חולים. הפעלת NRF2 ממלאת תפקיד במערכת ניקוי רעלים בשלב II. ניקוי רעלים משלב II לוקח רדיקלים חופשיים ליפופיליים, או מסיסים בשומן וממיר אותם לחומרים הידרופיליים, או מסיסים במים, חומרים להפרשה תוך השבתת מטבוליטים וכימיקלים יוצאי דופן במיוחד. של שלב I.

הפעלת NRF2 מפחיתה את החמצון הכללי ואת דלקת הגוף האנושי דרך אפקט הורמטי. כדי להפעיל NRF2, תגובה דלקתית עקב חמצון חייבת להתרחש על מנת התאים לייצר תגובה אדפטיבית וליצור נוגדי חמצון, כגון גלוטתיון. כדי לשבור את העיקרון של Nrf2, למעשה, מתח חמצוני מפעיל NRF2 אשר לאחר מכן מפעיל תגובה נוגדת חמצון בגוף האדם. NRF2 פונקציות לאיזון איתות החזרה, או שיווי המשקל של רמות חמצון נוגדי חמצון בתא.

ניתן להדגים המחשה נהדרת של אופן הפעולה של תהליך זה באמצעות תרגיל. בכל אימון השריר מסתגל כך שיוכל להכיל אימון נוסף. אם NRF2 מתבטא פחות או יותר בגלל זיהומים כרוניים או חשיפה מוגברת לרעלים, אשר ניתן להבחין בחולים הסובלים מתסמונת תגובה דלקתית כרונית, או CIRS, בעיות הבריאות עלולות להחמיר בעקבות הפעלת NRF2. מעל לכל, אם DJ-1 מתחמצן יתר על המידה, הפעלת NRF2 תסתיים מהר מדי.

ההשפעות של הפעלת NRF2

הפעלת NRF2 מתבטאת מאוד בריאות, בכבד ובכליות. גרעיני erythroid 2 גורם הקשורים 2, או NRF2, הנפוץ ביותר פונקציות על ידי נגד רמות מוגברת של חמצון בגוף האדם אשר יכול להוביל ללחץ חמצוני. Nrf2 ההפעלה יכולה לעזור לטפל במגוון בעיות בריאות, עם זאת, יתר ההפעלה של Nrf2 עלול להחריף בעיות שונות, אשר הוכיחו להלן.

הפעלה תקופתית של Nrf2 יכולה לסייע:

  • הזדקנות (כלומר אריכות ימים)
  • אוטואימוניות ודלקת כללית (דלקת פרקים, אוטיזם)
  • סרטן ו Chemoprotection (כלומר חשיפה EMF)
  • דיכאון וחרדה (כלומר PTSD)
  • חשיפה לסמים (אלכוהול, NSAIDs)
  • פעילות גופנית וסיבולת
  • מחלת גוט (כלומר, SIBO, Dysbiosis, קוליטיס כיבית)
  • מחלת כליות (כלומר, פגיעה בכליות חריפה, מחלת כליות כרונית, זאבת לופוס)
  • מחלות כבד (כלומר, מחלת כבד אלכוהולית, הפטיטיס חריפה, מחלת כבד לא שומנית, Nonalcoholic Steatohepatitis, שחמת)
  • מחלת ריאה (כלומר, אסטמה, פיברוזיס)
  • מחלות מטבוליות וכלי דם (כלומר, טרשת עורקים, יתר לחץ דם, שבץ, סוכרת)
  • Neurodegeneration (כלומר אלצהיימר, פרקינסון, הנטינגטון ו ALS)
  • כאב (כלומר נוירופתיה)
  • הפרעות עור (כלומר פסוריאזיס, UVB / הגנה מפני השמש)
  • חשיפה Toxin (ארסן, אסבסט, קדמיום, פלואוריד, גלייפוסט, מרקורי, אלח דם, עשן)
  • חזון (כלומר, אור בהיר, רגישות, קטרקט, ניוון הקרנית)

Hyperactivation של Nrf2 יכול להחמיר:

  • טרשת עורקים
  • סרטן (כלומר מוח, חזה, ראש, צוואר הלבלב, הערמונית, כבד, בלוטת התריס)
  • תסמונת תגובה דלקתית כרונית (CIRS)
  • השתלת לב (בעוד NRF2 פתוח עשוי להיות רע, NRF2 יכול לעזור עם תיקון)
  • הפטיטיס C
  • נפריטיס (במקרים חמורים)
  • ויטיליגו

יתר על כן, NRF2 יכול לעזור בתוספי תזונה ספציפיים, תרופות ותרופות לעבוד. תוספים טבעיים רבים יכולים גם לסייע בהפעלת NRF2. באמצעות מחקרים עדכניים החוקרים הוכיחו כי מספר רב של תרכובות שבעבר האמינו כי הם נוגדי חמצון הם באמת פרו-אוקסידנטים. הסיבה לכך היא שכמעט כולם זקוקים ל- NRF2 כדי לתפקד, אפילו תוספים כמו כורכומין ושמן דגים. לדוגמא, הוכח כי קקאו מייצר השפעות נוגדות חמצון בעכברים בעלי הגן NRF2.

דרכים להפעלת NRF2

במקרה של מחלות נוירודגנרטיביות כמו מחלת אלצהיימר, מחלת פרקינסון, שבץ או אפילו מחלות אוטואימוניות, זה כנראה הכי טוב שיש Nrf2 upregulated, אבל בצורה הורמטית. ערבוב NRF2 activators עשוי גם להיות אפקט תוסף או סינרגיסטי, כמו מדי פעם זה יכול להיות תלוי במינון. הדרכים המובילות להגדלת הביטוי Nrf2 מפורטות להלן:

  • HIST (תרגיל) + CoQ10 + Sun (אלה synergize טוב מאוד)
  • ברוקולי נבטים + LLLT על הראש שלי בטן
  • בוטיראטה + קפה סופר + בוקר
  • אקופונקטורה (זוהי שיטה חלופית, לייזר אקופונקטורה עשוי לשמש גם)
  • תַעֲנִית
  • קנבידיול (CBD)
  • האריה של מאנה + מלטונין
  • חומצה אלפא-ליפואית + DIM
  • לענה
  • הפעלת PPAR-gamma

הרשימה המקיפה הבאה המכילה מעל 350 דרכים אחרות להפעלת Nrf2 באמצעות דיאטה, סגנון חיים והתקנים, פרוביוטיקה, תוספים, עשבי תיבול ושמנים, הורמונים ונוירוטרנסמיטרים, תרופות / תרופות וכימיקלים, מסלולים / גורמי תעתוק, כמו גם דרכים אחרות, היא רק מדריך קצר לגבי מה יכול לגרום Nrf2. למען הקיצור במאמר זה, יש לנו נשאר מעל 500 מזונות אחרים, תוספי תזונה ותרכובות אשר יכול לעזור להפעיל Nrf2. להלן פירוט הנושאים הבאים:

דִיאֵטָה:

  • פרי האסאי
  • אלכוהול (יין אדום הוא טוב יותר, במיוחד אם יש פקק בו, כמו aldehyde protockchuic מ פקקים יכול גם להפעיל NRF2.בדרך כלל, אלכוהול לא מומלץ, למרות צריכת חריפה מגביר NRF2. צריכת כרוני עשוי להפחית NRF2.
  • אצות (אצה)
  • תפוחים
  • תה שחור
  • אֱגוזי ברזיל
  • ברוקולי נבטים (ו isothiocyanates אחרים, sulforaphane, כמו גם ירקות cruciferous כמו choy bok כי יש D3T)
  • אוכמניות (0.6-10 g / day)
  • גזר (falcarinone)
  • פאיין קאיין (קפסאיצין)
  • סלרי (Butylphthalide)
  • צ'אגה (בטולין)
  • תה קמומיל
  • Chia
  • תפוח אדמה סיני
  • צ'וקבריס (ארוניה)
  • שוקולד (כהה או קקאו)
  • קינמון
  • קפה (כגון חומצה כלורוגנית, Cafestol ו- Kahweol)
  • Cordyceps
  • דגים (ו צדפות)
  • זרעי פשתן
  • שׁוּם
  • Ghee (אולי)
  • ג'ינג'ר (וקרדמונין)
  • Gojiberries
  • אשכוליות (Naringenin - 50 מ"ג / ק"ג / d naringenin)
  • ענבים
  • תה ירוק
  • גויאבה
  • לב של פאלם
  • Hijiki / Wakame
  • חלת דבש
  • Kiwi
  • קטניות
  • רעמת אריה
  • מאהווה
  • מנגוס (מנגיפרין)
  • מנגוסטין
  • חלב (עז, פרה - דרך תקנה של מיקרוביום)
  • תותים
  • שמן זית (pomace - hydroxytyrosol וחומצה Oleanolic)
  • אומגה 6 חומצות שומן (Lipoxin A4)
  • Osange תפוזים (Morin)
  • פטריות צדפות
  • פָּאפַּאיָה
  • בוטנים
  • אפונת יונה
  • רימון (Punicalagin, חומצה Ellagic)
  • פרופוליס (Pinocembrin)
  • תפוחי אדמה סגולים
  • ראמבוטאן (גרניאן)
  • בצל
  • ריישי
  • רודיולה רוזה (סאלידרוסיד)
  • אורז סובין (cycloternyl ferulate)
  • רייסברי
  • תה רוויבוס
  • רוזמרין
  • מרווה
  • חריע
  • שמן שומשום
  • סויה (ו isoflavones, Daidzein, Genistein)
  • קישוא
  • תותים
  • כוסמת טרטרי
  • קורנית
  • עגבניות
  • שעועית Tonka
  • כורכום
  • וואסבי
  • אבטיח

סגנון חיים והתקנים:

  • אקופונקטורה ו electroacupuncture (דרך מפל קולגן על ECM)
  • אור כחול
  • המוח משחקים (מגביר NRF2 בהיפוקמפוס)
  • הגבלת קלוריות
  • קר (מקלחות, צולל, אמבט קרח, ציוד, cryotheraphy)
  • EMF (תדירות נמוכה, כגון PEMF)
  • פעילות גופנית (נראה כי פעילות גופנית חריפה כמו HIST או HIIT מועילה יותר לזירוז NRF2, בעוד שפעילות גופנית ארוכה יותר אינה גורמת ל- NRF2, אך כן מעלה את רמות הגלוטתיון)
  • דיאטה דלת שומן (דיאטה)
  • חום גבוה (סאונה)
  • שאיפת מימן ומימן
  • תרפיית חמצן היפרבית
  • תרפיה אינפרא אדום (כגון Joovv)
  • ויטמין C תוך ורידי
  • קטוגנית תזונה
  • אוֹזוֹן
  • עישון (לא מומלץ - עלייה חדה במעשנים NRF2, עישון כרוני מקטין את NRF2 אם תבחר לעשן, בזיל הקדוש עשוי לסייע בהגנה מפני דעיכה של NRF2)
  • יום ראשון (UVB ו אינפרא אדום)

פרוביוטיקה:

  • Bacillus subtilis (fmbJ)
  • Clostridium butyricum (MIYAIRI 588)
  • brevis קטובצילוס
  • Lactobacillus casei (SC4 ו- 114001)
  • לקטובצילוס
  • Lactobacillus gasseri (OLL2809, L13-Ia ו- SBT2055)
  • Lactobacillus helveticus (NS8)
  • Lacobacillus paracasei (NTU 101)
  • Lactobacillus plantarum (C88, CAI6, FC225, SC4)
  • Lactobacillus rhamnosus (GG)

תוספים, עשבי תיבול ושמנים:

  • אצטיל- L-Carnitine (ALCAR) וקרניטין
  • אליצין
  • חומצה אלפא-ליפואית
  • Amentoflavone
  • Andrographis paniculata
  • Agmatine
  • אפיגנין
  • ארגינין
  • ארטישוק (Cyanropicrin)
  • אשווגנדה
  • Astragalus
  • Bacopa
  • Beefsteak (Isogemaketone)
  • ברברין
  • בטא-קריופילן
  • ביידנס פילוסה
  • שמן זרעי כמון שחור (Thymoquinone)
  • Boswellia
  • Butein
  • בוטיראט
  • קנבידיול (CBD)
  • קרוטניואידים (כמו בטא קרוטן [סינרגיה עם ליקופן - 2 - 15 מ"ג / ד ליקופן], פוקוקסנטין, זקסנטין, אסטקסנטין ולוטאין)
  • Chitrak
  • Chlorella
  • כלורופיל
  • חרצית zawadskii
  • סינמומה
  • סאנדיו
  • נְחוֹשֶׁת
  • קופטיס
  • CoQ10
  • כורכומין
  • Damiana
  • דן שן / סייג אדום (מילטירון)
  • עָמוּם
  • Dioscin
  • דונג לינג קאו
  • דונג קואי (ג'ינסנג)
  • אקלוניה קאווה
  • EGCG
  • אלקמפאנה / אינולה
  • Eucommia לנבוח
  • חומצה פרולית
  • Fisetin
  • שמן דגים (DHA / EPA - 3 - שמן דגים 1 גרם / ד המכיל 1098 מ"ג EPA ו -549 מ"ג DHA)
  • גלאנגאל
  • גסטרודין (טיאן מא)
  • גנטיאנה
  • גרניום
  • גינקו בילובה (גינקגוליד ב)
  • זכוכית
  • Gotu קולה
  • תמצית זרעי ענבים
  • שרירי שעיר
  • חריטאקי (טריפלה)
  • עוזרד
  • הליכריסום
  • חינה (Juglone)
  • הִיבִּיסקוּס
  • Higenamine
  • בזיל הקדוש / טולסי (חומצה אורסולית)
  • כשות
  • מיובש עשב מיובש (Icarin / Icariside)
  • אינדיגו נטורליס
  • ברזל (לא מומלץ אלא אם כן חיוני)
  • I3C
  • דמעות של איוב
  • Moringa Oleifera (כגון Kaempferol)
  • Inchinkoto (משולבת של Zhi Zi ו סטמבל)
  • שורש קאדזו
  • שורש ליקוריץ
  • לינדרה רוט
  • לוטולין (מינונים גבוהים להפעלה, מינונים נמוכים יותר מעכבים את NRF2 בסרטן)
  • מגנוליה
  • Manjistha
  • Maximowiczianum (Acerogenin A)
  • ארניקה מקסיקנית
  • Milk Thistle
  • MitoQ
  • מו שיאנג
  • Mucuna Pruriens
  • ניקוטינמיד ו NAD +
  • Panax Ginseng
  • Passionflower (כגון Chrysin, אבל chyrisin עשוי גם להפחית NRF2 באמצעות dysregulation של איתות PI3K / Akt)
  • פאו דארקו (לפצ'ו)
  • Phloretin
  • Piceatannol
  • PQQ
  • Procyanidin
  • Pterostilbene
  • Pueraria
  • Quercetin (מינון גבוה בלבד, מינונים נמוכים יותר מעכבים את NRF2)
  • קיאנג הואו
  • תלתן אדום
  • Resveratrol (Piceid ו phytoestrogens אחרים בעצם, Knotweed)
  • פקעות ורדים
  • Rosewood
  • רוטין
  • סאפנווד
  • קיסוסית
  • סאורורוס צ'יננסיס
  • SC-E1 (גבס, יסמין, שוש, קודזו, פרח בלון)
  • Schisandra
  • עצמית לרפא (prunella)
  • Skullcap (Baicalin ו Wogonin)
  • חומעה כבשים
  • סי וו טאנג
  • סידיריטיס
  • ספיקנרד (ארליה)
  • ספירולינה
  • ג 'ון סנט wort
  • Sulforaphane
  • סאתרלנדיה
  • טאו הונג סי וו
  • טאורין
  • רעם אלוהים גפן (טריפטולידי)
  • טוקופרולים (כגון ויטמין E או Linalool)
  • טריבולוס R
  • טו סי זי
  • טודקה
  • ויטמין A (אם כי רטינואידים אחרים מעכבים את NRF2)
  • ויטמין C (מינון גבוה בלבד, מינון נמוך מעכב את ה- NRF2)
  • עץ Vitex / צנוע
  • פוני לבן (Paeoniflorin מ Paeonia lactiflora)
  • סטמבל (היספידולין וארטמיסינין)
  • שיאו יאו ואן (נודד חופשי וקל)
  • ירבה סנטה (Eriodictyol)
  • יואן Zhi (Tenuigenin)
  • Zi Cao (יפחית את NRF2 בסרטן)
  • אבץ
  • זיזיפוס

הורמונים ונוירוטרנסמיטורים:

  • אדיפונקטין
  • אדרופין
  • אסטרוגן (אך עשוי להפחית את NRF2 ברקמת השד)
  • מלטונין
  • פרוגסטרון
  • חומצה Quinolinic (בתגובה מגן כדי למנוע exitotoxicity)
  • סרוטונין
  • בלוטת התריס הורמונים כמו T3 (יכול להגדיל NRF2 בתאים בריאים, אבל להקטין אותו בסרטן)
  • ויטמין D

תרופות / תרופות וכימיקלים:

  • acetaminophen
  • אצכוזולמיד
  • Amlodipine
  • אורנופין
  • ברדוקסולון מתיל (BARD)
  • Benznidazole
  • BHA
  • CDDO-imidazolide
  • Ceftriaxone (ו- beta-lactam אנטיביוטיקה)
  • סיאליס
  • דקסאמתאזון
  • Diprivan (Propofol)
  • Eriodictyol
  • Exendin-4
  • Ezetimibe
  • פלואוריד
  • Fumarate
  • HNE (מחומצן)
  • Idazoxan
  • ארסן אורגני ונתרן ארסניט
  • JQ1 (עשוי לעכב NRF2 גם, לא ידוע)
  • Letairis
  • מלפלן
  • Methazolamide
  • Methylene כחול
  • Nifedipine
  • NSAIDs
  • אולטיפראז
  • PPIs (כגון Omeprazole ו Lansoprazole)
  • Protandim - תוצאות מצוינות in vivo, אבל חלש / לא קיים בהפעלת NRF2 בבני אדם
  • פרובוקול
  • rapamycin
  • Reserpine
  • רותניום
  • סיטקסנטאן
  • סטטינים (כגון ליפיטור וסימבסטטין)
  • טמוקסיפן
  • טאנג לואו נינג
  • tBHQ
  • Tecfidera (דימתיל fumarate)
  • THC (לא חזק כמו CBD)
  • תאופילין
  • Umbelliferone
  • חומצה Ursodeoxycholic (UDCA)
  • verapamil
  • ויאגרה
  • 4-Acetoxyphenol

מסלולים / תמלול גורמים:

  • ? 7 הפעלת nAChR
  • AMPK
  • אוֹדֶם הַמָרָה
  • CDK20
  • CKIP-1
  • CYP2E1
  • EAATs
  • גנקירין
  • שֵׁד
  • GJA1
  • H-ferritin ferroxidase
  • מעכבי HDAC (כגון חומצה valproic ו- TSA, אך עלולים לגרום לחוסר יציבות של NRF2)
  • מחממים הלם חלבונים
  • IL-17
  • IL-22
  • קלוטו
  • תן- 7 (דופק mBach1 RNA)
  • MAPK
  • מיכאל acceptors (ביותר)
  • miR-141
  • miR-153
  • miR-155 (דופק גם mBach1 RNA גם)
  • miR-7 (במוח, עוזר עם סרטן וסכיזופרניה)
  • Notch1
  • מתח חמצוני (כגון ROS, RNS, H2O2) ו Electrophiles
  • PGC-1?
  • PKC-delta
  • PPAR-gamma (אפקטים סינרגיסטיים)
  • סיגמא- 1 קולטן עיכוב
  • SIRT1 (מגביר את NRF2 במוח ובריאות, אך עשוי להקטין אותו באופן כללי)
  • SIRT2
  • SIRT6 (בכבד ובמוח)
  • SRXN1
  • TrxR1 עיכוב (הנחתה או דלדול גם כן)
  • אבץ פרוטופורפירי
  • 4-HHE

אַחֵר:

  • אנקאלאבין
  • אזבסט
  • אביצנים
  • Bacillus amyloliquefaciens (המשמשים בחקלאות)
  • פחמן חד חמצני
  • דפנטין
  • דלדול גלוטתיון (דלדול של 80% - 90% אולי)
  • התעמלות קוריאנסיס
  • הפטיטיס C
  • הרפס (HSV)
  • עץ אפר הודי
  • שורש Indigowoad
  • Isosalipurposide
  • Isorhamentin
  • מונאסקין
  • Omaveloxolone (חזק, aka RTA-408)
  • PDTC
  • מחסור בסלניום (מחסור בסלניום יכול להגדיל את NRF2)
  • סיביר
  • Sophoraflavanone G
  • Tadehagi משולש
  • Toona sinensis (7-DGD)
  • פרח חצוצרה
  • 63171 ו- 63179 (חזק)
ד"ר חימנז לבן מעיל
הגרעין erythroid 2 הקשורים גורם 2 נתיב איתות, הידועה ביותר על ידי ראשי תיבות Nrf2, הוא גורם שעתוק אשר ממלא את התפקיד העיקרי של ויסות מנגנוני הגנה נוגדי חמצון מגן של גוף האדם, במיוחד על מנת לשלוט מתח חמצוני. בעוד רמות גבוהות של מתח חמצוני יכול להפעיל Nrf2, ההשפעות שלה משופרת באופן משמעותי באמצעות נוכחות של תרכובות ספציפיות. מאכלים מסוימים ותוספי מזון מסייעים בהפעלת Nrf2 בגוף האדם, כולל isothiocyanate sulforaphane מנבטי ברוקולי. ד"ר אלכס Jimenez DC, תובנה CCST

Sulforaphane והשפעותיו על סרטן, תמותה, הזדקנות, מוח והתנהגות, מחלות לב ועוד

Isothiocyanates הם כמה תרכובות צמח החשוב ביותר שאתה יכול לקבל בתזונה. בסרטון זה אני עושה את המקרה המקיף ביותר עבור אותם כי היה אי פעם. טווח קשב קצר? דלג לנושא המועדף עליך על ידי לחיצה על אחת מנקודות הזמן הבאות. ציר זמן מלא להלן.

מקטעי מפתח:

  • 00: 01 - סרטן ותמותה
  • 00: 19 - הזדקנות
  • 00: 26: 30 - המוח וההתנהגות
  • 00: 38 - סיכום סופי
  • 00: 40 - מינון

ציר זמן מלא:

  • 00: 00: 34 - מבוא של sulforaphane, מוקד עיקרי של הסרטון.
  • 00: 01: 14 - הצריכה של הצומח הצמח והפחתת בתמותה מכל הסיבות.
  • 00: 02 - סיכון לסרטן הערמונית.
  • 00: 02 - סיכון לסרטן שלפוחית ​​השתן.
  • 00: 02 - סרטן הריאה אצל מעשנים מסתכן.
  • 00: 02 - סיכון לסרטן השד.
  • 00: Hypothetical: מה אם כבר יש לך סרטן? (התערבות)
  • 00: 03: 35 - מנגנון מתקבל על הדעת המניע את הנתונים התמותה הסרטן ותמותה.
  • 00: 04 - Sulforaphane וסרטן.
  • 00: 05: 32 - ראיות לבעלי חיים המראים השפעה חזקה של ברוקולי לנבוט לחלץ על התפתחות שלפוחית ​​השתן בעכברים.
  • 00: 06 - השפעת תוסף ישיר של sulforaphane בחולי סרטן הערמונית.
  • 00: 07: 09 - ביואקומולציה של מטבוליטים איסוציאיאנט ברקמת השד בפועל.
  • 00: 08: 32 - עיכוב של תאי גזע סרטן השד.
  • 00: 08: 53 - שיעור היסטוריה: brassicas הוקמו כבעלי תכונות בריאותיות גם ברומא העתיקה.
  • 00: 09 - היכולת של Sulforaphane כדי לשפר את הפרשת מסרטן (בנזין, acrolein).
  • 00: 09 - NRF51 כמתג גנטי באמצעות רכיבי תגובה נוגדי חמצון.
  • 00: 10 - כיצד NRF10 ההפעלה משפר הפרשת מסרטן באמצעות גלוטתיון- S-conjugates.
  • 00: 10: 34 - נבטים בריסל להגדיל גלוטתיון- S-transferase ולהפחית נזק ל- DNA.
  • 00: 11 - ברוקולי לנבוט משקה מגביר הפרשת בנזין על ידי 20%.
  • 00: 13: 31 - ברוקולי לנבוט homogenate מגביר אנזימים נוגדי חמצון בדרכי הנשימה העליונות.
  • 00: 15: צריכת הצליבה הצמחית ותמותה ממחלות לב.
  • 00: 16 - ברוקולי נובט אבקת משפר את רמת השומנים בדם ואת הסיכון למחלות לב כל סוג של חולי סוכרת מסוג 55.
  • 00: 19 - תחילת סעיף ההזדקנות.
  • 00: 19 - דיאטה עשירה ב- Sulforaphane משפרת תוחלת חיים של חיפושיות מ- 21 ל- 15% (בתנאים מסוימים).
  • 00: 20 - חשיבותה של דלקת נמוכה לאריכות ימים.
  • 00: 22: CROCiferous ירקות ברוקולי נבט אבקה נראה להקטין מגוון רחב של סמנים דלקתיים בבני אדם.
  • 00: 23: 40 - סיכום וידאו: סרטן, קטעים מזדקנים
  • 00: 24: 14 - מחקרים שנעשו על ידי עכברים מצביעים על כך ש- sulforaphane עשוי לשפר את תפקוד המערכת החיסונית הזקנה בגיל מבוגר.
  • 00: 25 - שיפור צבע השיער גדל במודל עכבר של מקריח. תמונה ב 18: 00: 26.
  • 00: 26 - התחלה של המוח והתנהגות סעיף.
  • 00: 27: 18 - השפעת ברוקולי לנבוט לחלץ על אוטיזם.
  • 00: 27: 48 - השפעת glucoraphanin על סכיזופרניה.
  • 00: 28: 17 - תחילת הדיון בדיכאון (מנגנון ומחקרים סבירים).
  • 00: 31 - מחקר עכבר באמצעות 21 דגמים שונים של לחץ המושרה על-ידי דיכאון הראה sulforaphane ביעילות דומה כמו fluoxetine (prozac).
  • 00: 32: 00 - מחקר מראה בליעה ישירה של glucoraphanin בעכברים הוא יעיל באופן דומה במניעת דיכאון מ תבוסה חברתית מודל הלחץ.
  • 00: 33 - תחילתו של קטע neurodegeneration.
  • 00: 33 - Sulforaphane ואלצהיימר.
  • 00: 33 - Sulforaphane ומחלת פרקינסון.
  • 00: 33 - Sulforaphane והונגטינגטון.
  • 00: 34: 13 - Sulforaphane מגביר את החלבונים בהלם חום.
  • 00: 34 - תחילתו של סעיף פגיעה מוחית טראומטית.
  • 00: 35: 01 - Sulforaphane מוזרק מיד לאחר TBI משפר זיכרון (מחקר העכבר).
  • 00: 35: 55 - Sulforaphane ופלסטיות עצבית.
  • 00: 36: 32 - Sulforaphane משפר את הלמידה במודל של סוכרת מסוג II בעכברים.
  • 00: 37: 19 - Sulforaphane ו Duchenne ניוון שרירים.
  • 00: 37: עיכוב מיוסטטין בתאי לווין שרירים (במבחנה).
  • 00 - 38: 06: סיבת וידאו מאוחרת: תמותה וסרטן, נזק ל- DNA, מתח חמצוני ודלקת, הפרשת בנזן, מחלות לב וכלי דם, סוכרת מסוג II, השפעות על המוח (דיכאון, אוטיזם, סכיזופרניה, ניוון מוחי), נתיב NRF2.
  • 00: 40 - מחשבות על חישוב מנה של נבטי ברוקולי או sulforaphane.
  • 00: 41: אנקדוטות על הנבטה בבית.
  • 00: על טמפרטורת בישול ופעילות sulforaphane.
  • 00: 43: 45 - חיידקי הבטן המרה של sulforaphane מ glucoraphanin.
  • 00: 44 - תוספי מזון טובים יותר בשילוב עם מירוזינאז פעיל מירקות.
  • 00: 44 - טכניקות בישול וירקות cruciferous.
  • 00: 46 - Isothiocyanates כמו goitrogens.

על פי מחקרים רבים העדכניים, מסלול האיתות לגורם 2 הקשורים ל- erythroid 2, הידוע בעיקר בשם Nrf2, הוא גורם תעתיק מהותי המפעיל את מנגנוני נוגדי החמצון המגנים של התאים לניקוי רעלים מהגוף האנושי מגורמים חיצוניים ופנימיים כאחד ומניעת הגדלתם. רמות של מתח חמצוני. היקף המידע שלנו מוגבל לבעיות בריאות כירופרקטיקה ובעמוד השדרה. כדי לדון בנושא, אל תהסס לשאול את ד"ר חימנז או ליצור איתנו קשר בכתובת 915-850-0900 .

אושר על ידי ד"ר אלכס Jimenez

לחצן התקשרות הירוק H. PNG

דיון בנושא נוסף: "כאבי גב חריפים

כאב גבזהו אחד הגורמים השכיחים ביותר לנכות וימי החמצה בעבודה ברחבי העולם. כאבי גב מייחסים את הסיבה השנייה בשכיחותה לביקורים במשרדי רופאים, שנמצאים במספרם רק בזיהומים בדרכי הנשימה העליונות. כ- 80 אחוז מהאוכלוסייה יחוו כאבי גב לפחות פעם אחת במהלך חייהם. עמוד השדרה הוא מבנה מורכב המורכב מעצמות, מפרקים, רצועות ושרירים, בין רקמות רכות אחרות. פציעות ו / או תנאים מחמירים, כגון דיסקים, יכול בסופו של דבר להוביל לסימפטומים של כאבי גב. פציעות ספורט או פגיעות בתאונות דרכים הן לעיתים קרובות הגורם השכיח ביותר לכאבי גב, אולם לפעמים התנועות הפשוטות ביותר יכולות לגרום לתוצאות כואבות. למרבה המזל, אפשרויות טיפול אלטרנטיביות, כמו טיפול כירופרקטי, יכולות לעזור להקל על כאבי גב באמצעות התאמות בעמוד השדרה ומניפולציות ידניות, ובסופו של דבר לשפר את הקלה בכאב.

תמונה של הילד קריקטורה

EXTRA EXTRA | חשוב נושא: מומלץ אל Paso, TX Chiropractor

***

מה הם היתרונות של Nrf2?

מה הם היתרונות של Nrf2?

מתח חמצוני הוא תורם מרכזי בפיתוח של מגוון רחב של בעיות בריאות, כולל סרטן, מחלות לב, סוכרת, הזדקנות מואצת neurodegeneration. נוגדי חמצון מזון עשיר, עשבי תיבול ותוספי יכול להיות מנוצל כדי להגן על הגוף האנושי מרמות גבוהות של מתח חמצוני. מחקרים שנעשו לאחרונה הראו כי נתיב Nrf2 הגן יכול לעזור להגביר את ההשפעות של נוגדי חמצון. ה היתרונות של Nrf2 מתוארים להלן.

מגן על הגוף מפני רעלים

NRF2 הוא חומר מהותי שיכול להגן על התאים מפני תרכובות מזיקות, פנימיות וחיצוניות. NRF2 עשוי לעזור להעשיר את תגובת גוף האדם לתרופות / תרופות ורעלים, ולשפר את ייצורם של חלבונים המסייעים בסילוק תרכובות מהתא, המכונות חלבונים הקשורים לתנגודת רב-תרופתית, או MRP. בדרך של מקרה, NRF2 מופעל לאחר שאיפת עשן סיגריות כדי לאפשר לריאות ניקוי רעלים.

בנוסף, חיוני לריאות להגן על עצמן מפני אלרגנים, מחלות נגיפיות, אנדוטוקסינים חיידקיים, היפרוקסיה ומזהמים סביבתיים שונים. הטריגר המתמיד של Nrf2 לעומת זאת, יכול להפחית את רמות החומר המכונה גלוטתיון בכל גוף האדם. NRF2 עשוי גם להגן על הכבד מפני רעילות והוא יכול להגן על הכבד מפני רעילות כבד נגד ארסן. יתר על כן, NRF2 מגן על הכבד והמוח מפני צריכת אלכוהול. למשל, Nrf2 יכול להגן על רעילות פרצטמול.

נלחם דלקת חמצון מתח

הפעלת NRF2 יכולה לסייע במאבק נגד דלקת על ידי צמצום של ציטוקינים דלקתיים, כגון אלה הקיימים בפסוריאזיס. NRF2 עשוי גם להפחית את הדלקת המשויכת למגוון של בעיות בריאותיות כמו דלקת מפרקים ופיברוזיס של הכבד, הכליות והריאות. NRF2 עשוי גם לסייע לשלוט באלרגיות על ידי הפחתת ציטוקינים TH1 / Th17 והעלאת ציטוקינים TH2. זה יכול להיות מועיל למחלות כמו אסתמה.

בנוסף, NRF2 מגן מפני נזקים תאיים מאור כחול ומ UVA / UVB שנמצא באור השמש. ליקויים ב- Nrf2 יכולים להקל על כוויות שמש. נימוק אחד מאחורי זה הוא מכיוון ש- NRF2 מסוגל לווסת קולגן בתגובה לקרינת UV. מוצרי קצה לגליקציה מתקדמים, או AGEs, תורמים לפיתוח בעיות בריאותיות רבות, כולל סוכרת ומחלות ניווניות. NRF2 יכול להפחית את הלחץ החמצוני של גילאים בגוף. NRF2 עשוי גם להגן על גוף האדם מפני רמות גבוהות יותר של לחץ מבוסס חום.

משפר את הביצועים המיטוכונדריה והתעמלות

NRF2 הוא מאיץ מיטוכונדריאלי. הפעלת NRF2 תורמת לעלייה באנרגיית ה- ATP למיטוכונדריה, בנוסף לשימוש משופר בחמצן, או ציטראט ושומן. ללא NRF2, למיטוכונדריה תהיה יכולת לתפקד עם סוכר או גלוקוז ולא עם שומן. NRF2 חיוני גם להתפתחות המיטוכונדריה באמצעות תהליך המכונה ביוגנזה. הפעלת NRF2 חיונית על מנת לנצל את היתרונות של פעילות גופנית.

בגלל הפעילות של NRF2, פעילות גופנית מעלה את התפקוד המיטוכונדריאלי, כאשר תוצאה זו עשויה להיות מוגברת באמצעות CoQ10, Cordyceps והגבלה קלורית. פעילות גופנית מתונה או פעילות גופנית חריפה גורמת לביוגנזה של המיטוכונדריה וסינתזה מוגברת של דיסמוטאז סופר-חמצני, או SOD, ו- heme-oxygenase-1, או HO-1, באמצעות הפעלת NRF2. חומצה אלפא-ליפואית, או ALA, ודן שן יכולים להגביר את הביוגנזה המיטוכונדריאלית המתווכת באמצעות NRF2. יתר על כן, NRF2 יכול גם לשפר את סובלנות הפעילות הגופנית כאשר מחיקת NRF2 הופכת את הפעילות הגופנית למזיקה.

מגן מפני היפוקסיה

NRF2 גם מסייע להגן על הגוף האנושי מפני אובדן חמצן הסלולר / דלדול, בעיה בריאותית הנקראת היפוקסיה. אנשים עם CIRS הפחיתו רמות חמצן מאז NRF2 שלהם נחסמה, וכתוצאה מכך רמות מופחת של VEGF, HIF1, ו- HO-1. בדרך כלל, אצל אנשים בריאים עם היפוקסיה, miR-101, אשר נדרש ליצירת תאי גזע, מוגזמים יתר על המידה ומשפרים כמויות של NRF2 / HO-1 ו- VEGF / eNOS, ולכן מונעים נזק מוחי, אך זה אינו מתרחש ב CIRS.

היפוקסיה, מאופיינת HIF1 נמוך, ב CIRS יכול גם לגרום מחסום דם דליפת דולף בשל חוסר איזון NRF2. Salidroside, הממוקם Rhodiola, פונקציות על ההפעלה NRF2 ומסייע עם היפוקסיה על ידי הגדלת רמות של VEGF ו HIF1 בתוך גוף האדם. NRF2 יכול גם בסופו של דבר להגן מפני הצטברות חלבון בלב. הפעלה של NRF2 עשויה גם להפסיק את מחלת החמצן הנגרמת על ידי היפוקסיה, או AMS.

מאט את ההזדקנות

מספר תרכובות שעלולות להיות קטלניות בכמויות אדירות עשויות להגדיל את אריכות החיים בכמויות זעירות למדי עקב קסנוורזה דרך NRF2, PPAR-gamma ו- FOXO. כמות קטנה של רעלים מעלה את יכולתו של התא להיות מצויד יותר בפעם הבאה שהוא יתמודד עם רעלן, אולם אין זה תמיכה לצרוך כימיקלים רעילים.

המחשה טובה לתהליך זה היא עם הגבלה קלורית. NRF2 יכול לשפר את תוחלת החיים של התאים על ידי העלאת רמות המיטוכונדריה ונוגדי החמצון, כמו גם הורדת יכולת התאים למות. NRF2 יורד עם ההזדקנות מכיוון ש- NRF2 מונע מתאי גזע למות ומסייע להם להתחדש. NRF2 ממלא תפקיד בשיפור ריפוי הפצעים.

משפר את מערכת כלי הדם

נעשה כראוי עם הייצור של sulforaphane, NRF2 ההפעלה עשויה להגן מפני מחלות לב כמו לחץ דם גבוה, או יתר לחץ דם, התקשות של העורקים, או טרשת עורקים. NRF2 יכול לשפר את Acetylcholine, או ACH, פעילות מרגיעה על מערכת כלי הדם תוך הפחתת מתח המושרה כולסטרול. Nrf2 ההפעלה עשויה לחזק את הלב, לעומת זאת, יתר על המידה Nrf2 יכול להעלות את ההסתברות של מחלות לב וכלי דם.

סטטינים עשויים למנוע או לגרום למחלות לב וכלי דם. NRF2 גם משחק תפקיד מרכזי באיזון ברזל וסידן אשר עשוי להגן על גוף האדם מפני רמות גבוהות של ברזל. לדוגמה, Sirtuin 2, או SIRT2, יכול להסדיר הומיאוסטזיס ברזל בתאים על ידי הפעלה של NRF2 אשר הוא האמין להיות נדרש ברמות ברזל בריא. NRF2 יכול גם לעזור עם מחלה מגל סלולרי, או SCD. תפקוד לקוי של NRF2 עשוי להיות סיבה מאחורי אנדוטוקסמיה כמו עם dysbiosis או לקטינים המושרה לחץ יתר. Nrf2 עשוי גם להגן על הגוף האנושי מפני הנזק שנגרם amphetamine למערכת הדם.

נלחם נוירואינפלאמציה

NRF2 יכול להגן מפני ולסייע עם דלקת של המוח, המכונה בדרך כלל neuroinflammation. יתר על כן, NRF2 יכול לעזור עם מבחר של מערכת העצבים המרכזית, או CNS, כולל:

  • מחלת אלצהיימר (AD) - מפחיתה את לחץ הבטן עמילואיד על המיטוכונדריה
  • טרשת לרוחב Amyotrophic (ALS)
  • Huntington של מחלות (HD)
  • טרשת נפוצה (MS)
  • התחדשות של עצבים
  • מחלת פרקינסון (PD) - מגן על דופמין
  • פגיעה בעמוד השדרה (SCI)
  • שבץ (איסכמי והמורגי) - עזרי חמצן
  • פגיעה מוחית טראומטית

NRF2 חשף ירידה בדלקת עצבית בבני נוער עם הפרעות בספקטרום האוטיסטי או ASD. Idebenone מזדווג כראוי עם מפעילי NRF2 בניגוד לדלקת עצבית. NRF2 עשוי גם לשפר את מחסום המוח בדם, או BBB. למשל, הפעלת NRF2 עם חומצה קרנוזית המתקבלת מרוזמרין ומרווה יכולה לחצות את ה- BBB ולגרום לנוירוגנזה. הוכח כי NRF2 גם מעלה את גורם הגורם הנוירוטרופי הנגזר, או BDNF.

NRF2 גם מווסת כמה יכולות של תוספי תזונה בכדי לגרום לגורם גדילה עצבי, או NGF מכיוון שהוא יכול גם לסייע בערפל במוח ובעיות הנגרמות על ידי גלוטמט על ידי ויסות N-Methyl-D-Aspartate, או קולטני NMDA זה עשוי גם להוריד את הלחץ החמצוני מחומצה קווינולנית, המכונה QUIN. הפעלת NRF2 יכולה להגן מפני התקפים ומינונים גדולים יכולים להפחית את סף ההתקף. במינונים קבועים של גירוי, NRF2 יכול לשפר את היכולות הקוגניטיביות לאחר התקף על ידי הורדת גלוטמט חוץ-תאי במוח ועל ידי יכולתו לשאוב ציסטאין מגלוטמט וגלוטתיון.

מקל על דיכאון

בדיכאון, זה נורמלי להבחין דלקת במוח, במיוחד מן הקורטקס הפריפרונטלי ההיפוקמפוס, כמו גם ירידה BDNF. בגרסאות מסוימות של דיכאון, NRF2 יכול לשפר את הסימפטומים הדיכאוניים על ידי הורדת דלקת בתוך המוח והגברת רמות BDNF. היכולת של Agmatine להקטין דיכאון על ידי העלאת noradrenaline, דופמין, סרוטונין, BDNF בהיפוקמפוס תלוי ההפעלה NRF2.

מכיל תכונות אנטי-סרטניות

NRF2 הוא גם מדכא הגידול כפי שהוא מקדם הגידול אם לא הצליח בהתאם. NRF2 יכול להגן מפני סרטן שנגרם על ידי רדיקלים חופשיים או מתח חמצוני, עם זאת, NRF2 overexpression ניתן למצוא גם בתאי הסרטן. הפעלה אינטנסיבית של NRF2 יכולה לסייע עם מגוון רחב של סוגי סרטן. לדוגמה, התוסף Protandim יכול להפחית את סרטן העור על ידי הפעלת NRF2.

מקל על כאב

מחלת המלחמה במפרץ, או GWI, מחלה בולטת המשפיעה על ותיקי מלחמת המפרץ, היא אוסף של תסמינים כרוניים לא מוסברים העלולים לכלול עייפות, כאבי ראש, כאבי מפרקים, בעיות עיכול, נדודי שינה, סחרחורת, מחלות נשימה ובעיות זיכרון. NRF2 יכול לשפר את הסימפטומים של GWI על ידי צמצום דלקת בהיפוקמפוס בכלל, בנוסף להקטנת הכאב. NRF2 יכול גם לסייע בכאב מפציעה עצבית בגוף ולשפר נזק עצבי מ נוירופתיה סוכרתית.

משפר את הסוכרת

רמות גלוקוז גבוהות, המכונה הטוב ביותר hyperglycemia, גורם נזק חמצוני לתאים עקב הפרעה של תפקוד המיטוכונדריה. הפעלת NRF2 עשויה להגן על גוף האדם מפני פגיעה של היפרגליקמיה בתא, ובכך למנוע מוות של תאים. הפעלת NRF2 יכולה גם להגן, לשחזר ולשפר את תפקוד תאי הבטאבלב, תוך צמצום ההתנגדות לאינסולין.

מגן על חזון ושמיעה

NRF2 יכול להגן מפני פגיעה בעין מ רטינופתיה סוכרתית. זה יכול גם למנוע היווצרות של קטרקט להגן על photoreceptors בניגוד למוות אור המושרה. NRF2 בנוסף מגן על האוזן, או שבלול, מפני איבוד מתח ושמיעה.

אולי לעזור להשמנת יתר

NRF2 עשוי לעזור בהשמנה בעיקר בשל יכולתו לווסת משתנים הפועלים על הצטברות שומן בגוף האדם. הפעלת NRF2 עם sulforaphane יכולה להעלות את העכבות של סינתזה של חומצות שומן, או FAS ו- Uncoupling Proteins, או UCP, וכתוצאה מכך פחות הצטברות שומן ויותר שומן חום, המאופיינות כשומן הכולל עוד מיטוכונדריה.

מגן על הבטן

NRF2 מסייע להגן על המעיים על ידי שמירה על הומאוסטזיס המעי הגס. לדוגמה, Proctotics lactobacillus יפעילו NRF2 כדי לשמור על הבטן מפני מתח חמצוני. NRF2 יכול גם לסייע במניעת קוליטיס כיבית, או UC.

מגן על האורגנים

NRF2 יכול להגן על האשכים ולשמור על ספירת זרע מפני פגיעה באנשים עם סוכרת. זה יכול גם לסייע בתפקוד לקוי של זיקפה, או ED. כמה תוספי תזונה להגברת הליבידו כמו Mucuna, Tribulus ו- Ashwaganda עשויים לשפר את התפקוד המיני באמצעות הפעלת NRF2. גורמים אחרים המגבירים את NRF2, כגון אור שמש או נבטי ברוקולי, יכולים גם הם לעזור בשיפור החשק המיני.

מסדיר עצמות ושרירים

מתח חמצוני עלול לגרום לצפיפות העצם ולהפחתת כוח, דבר המקובל באוסטיאופורוזיס. NRF2 הפעלה יכולה להיות היכולת לשפר נוגדי חמצון בעצמות ולהגן מפני הזדקנות העצם. NRF2 יכול גם למנוע אובדן שרירים ולשפר Duchenne Muscular Dystrophy, או DMD.

מכיל אנטי ויראלי נכסים

אחרון חביב, הפעלת NRF2 יכולה בסופו של דבר לסייע בהגנה על גוף האדם מפני מספר נגיפים. בחולים עם נגיף הדנגי, הסימפטומים לא היו כה עזים אצל אנשים שהיו להם רמות גבוהות יותר של NRF2 בהשוואה לאנשים שהיו להם פחות דרגות של NRF2. NRF2 יכול גם לעזור לאנשים שיש להם וירוס חיסוני אנושי 1, או HIV. NRF2 יכול להגן מפני לחץ חמצוני מנגיף Adeno-Associated, או AAV ו- H. Pylori. לבסוף, שורש לינדרה עשוי לדכא את נגיף הפטיטיס C עם הפעלת NRF2.

ד"ר חימנז לבן מעיל
Nrf2, או NF-E2 גורם הקשור 2, הוא גורם שעתוק נמצא בבני אדם אשר מסדיר את הביטוי של קבוצה מסוימת של נוגדי חמצון ו detoxifying גנים. מסלול איתות זה מופעל בשל לחץ חמצוני כפי שהוא משפר רבים נוגדי חמצון בשלב II אנזימים דטוקסיפיקציה הכבד לשחזר הומיאוסטזיס בגוף האדם. בני אדם מותאמים לתפקוד בכל מצב של הומאוסטזיס או איזון. כאשר הגוף הוא מתמודד עם מתח חמצוני, Nrf2 מפעיל כדי להסדיר חמצון ולשלוט על הלחץ שהוא גורם. Nrf2 חיוני כדי למנוע בעיות בריאותיות הקשורות ללחץ חמצוני. ד"ר אלכס Jimenez DC, תובנה CCST

Sulforaphane והשפעותיו על סרטן, תמותה, הזדקנות, מוח והתנהגות, מחלות לב ועוד

Isothiocyanates הם כמה תרכובות צמח החשוב ביותר שאתה יכול לקבל בתזונה. בסרטון זה אני עושה את המקרה המקיף ביותר עבור אותם כי היה אי פעם. טווח קשב קצר? דלג לנושא המועדף עליך על ידי לחיצה על אחת מנקודות הזמן הבאות. ציר זמן מלא להלן.

מקטעי מפתח:

  • 00: 01 - סרטן ותמותה
  • 00: 19 - הזדקנות
  • 00: 26: 30 - המוח וההתנהגות
  • 00: 38 - סיכום סופי
  • 00: 40 - מינון

ציר זמן מלא:

  • 00: 00: 34 - מבוא של sulforaphane, מוקד עיקרי של הסרטון.
  • 00: 01: 14 - הצריכה של הצומח הצמח והפחתת בתמותה מכל הסיבות.
  • 00: 02 - סיכון לסרטן הערמונית.
  • 00: 02 - סיכון לסרטן שלפוחית ​​השתן.
  • 00: 02 - סרטן הריאה אצל מעשנים מסתכן.
  • 00: 02 - סיכון לסרטן השד.
  • 00: Hypothetical: מה אם כבר יש לך סרטן? (התערבות)
  • 00: 03: 35 - מנגנון מתקבל על הדעת המניע את הנתונים התמותה הסרטן ותמותה.
  • 00: 04 - Sulforaphane וסרטן.
  • 00: 05: 32 - ראיות לבעלי חיים המראים השפעה חזקה של ברוקולי לנבוט לחלץ על התפתחות שלפוחית ​​השתן בעכברים.
  • 00: 06 - השפעת תוסף ישיר של sulforaphane בחולי סרטן הערמונית.
  • 00: 07: 09 - ביואקומולציה של מטבוליטים איסוציאיאנט ברקמת השד בפועל.
  • 00: 08: 32 - עיכוב של תאי גזע סרטן השד.
  • 00: 08: 53 - שיעור היסטוריה: brassicas הוקמו כבעלי תכונות בריאותיות גם ברומא העתיקה.
  • 00: 09 - היכולת של Sulforaphane כדי לשפר את הפרשת מסרטן (בנזין, acrolein).
  • 00: 09 - NRF51 כמתג גנטי באמצעות רכיבי תגובה נוגדי חמצון.
  • 00: 10 - כיצד NRF10 ההפעלה משפר הפרשת מסרטן באמצעות גלוטתיון- S-conjugates.
  • 00: 10: 34 - נבטים בריסל להגדיל גלוטתיון- S-transferase ולהפחית נזק ל- DNA.
  • 00: 11 - ברוקולי לנבוט משקה מגביר הפרשת בנזין על ידי 20%.
  • 00: 13: 31 - ברוקולי לנבוט homogenate מגביר אנזימים נוגדי חמצון בדרכי הנשימה העליונות.
  • 00: 15: צריכת הצליבה הצמחית ותמותה ממחלות לב.
  • 00: 16 - ברוקולי נובט אבקת משפר את רמת השומנים בדם ואת הסיכון למחלות לב כל סוג של חולי סוכרת מסוג 55.
  • 00: 19 - תחילת סעיף ההזדקנות.
  • 00: 19 - דיאטה עשירה ב- Sulforaphane משפרת תוחלת חיים של חיפושיות מ- 21 ל- 15% (בתנאים מסוימים).
  • 00: 20 - חשיבותה של דלקת נמוכה לאריכות ימים.
  • 00: 22: CROCiferous ירקות ברוקולי נבט אבקה נראה להקטין מגוון רחב של סמנים דלקתיים בבני אדם.
  • 00: 23: 40 - סיכום וידאו: סרטן, קטעים מזדקנים
  • 00: 24: 14 - מחקרים שנעשו על ידי עכברים מצביעים על כך ש- sulforaphane עשוי לשפר את תפקוד המערכת החיסונית הזקנה בגיל מבוגר.
  • 00: 25 - שיפור צבע השיער גדל במודל עכבר של מקריח. תמונה ב 18: 00: 26.
  • 00: 26 - התחלה של המוח והתנהגות סעיף.
  • 00: 27: 18 - השפעת ברוקולי לנבוט לחלץ על אוטיזם.
  • 00: 27: 48 - השפעת glucoraphanin על סכיזופרניה.
  • 00: 28: 17 - תחילת הדיון בדיכאון (מנגנון ומחקרים סבירים).
  • 00: 31 - מחקר עכבר באמצעות 21 דגמים שונים של לחץ המושרה על-ידי דיכאון הראה sulforaphane ביעילות דומה כמו fluoxetine (prozac).
  • 00: 32: 00 - מחקר מראה בליעה ישירה של glucoraphanin בעכברים הוא יעיל באופן דומה במניעת דיכאון מ תבוסה חברתית מודל הלחץ.
  • 00: 33 - תחילתו של קטע neurodegeneration.
  • 00: 33 - Sulforaphane ואלצהיימר.
  • 00: 33 - Sulforaphane ומחלת פרקינסון.
  • 00: 33 - Sulforaphane והונגטינגטון.
  • 00: 34: 13 - Sulforaphane מגביר את החלבונים בהלם חום.
  • 00: 34 - תחילתו של סעיף פגיעה מוחית טראומטית.
  • 00: 35: 01 - Sulforaphane מוזרק מיד לאחר TBI משפר זיכרון (מחקר העכבר).
  • 00: 35: 55 - Sulforaphane ופלסטיות עצבית.
  • 00: 36: 32 - Sulforaphane משפר את הלמידה במודל של סוכרת מסוג II בעכברים.
  • 00: 37: 19 - Sulforaphane ו Duchenne ניוון שרירים.
  • 00: 37: עיכוב מיוסטטין בתאי לווין שרירים (במבחנה).
  • 00 - 38: 06: סיבת וידאו מאוחרת: תמותה וסרטן, נזק ל- DNA, מתח חמצוני ודלקת, הפרשת בנזן, מחלות לב וכלי דם, סוכרת מסוג II, השפעות על המוח (דיכאון, אוטיזם, סכיזופרניה, ניוון מוחי), נתיב NRF2.
  • 00: 40 - מחשבות על חישוב מנה של נבטי ברוקולי או sulforaphane.
  • 00: 41: אנקדוטות על הנבטה בבית.
  • 00: על טמפרטורת בישול ופעילות sulforaphane.
  • 00: 43: 45 - חיידקי הבטן המרה של sulforaphane מ glucoraphanin.
  • 00: 44 - תוספי מזון טובים יותר בשילוב עם מירוזינאז פעיל מירקות.
  • 00: 44 - טכניקות בישול וירקות cruciferous.
  • 00: 46 - Isothiocyanates כמו goitrogens.

כאשר גוף האדם מתמודד עם גורמים פנימיים וחיצוניים מזיקים כמו רעלים, על התאים להפעיל במהירות את יכולותיהם האנטי-אוקסידנטיות כדי לנטרל מתח חמצוני. מכיוון שנקבעו כי רמות מוגברות של מתח חמצוני גורמות למגוון בעיות בריאותיות, חשוב להשתמש בהפעלת Nrf2 כדי לנצל את היתרונות שלו. היקף המידע שלנו מוגבל לבעיות בריאות כירופרקטיקה ובעמוד השדרה. כדי לדון בנושא, אל תהסס לשאול את ד"ר חימנז או ליצור איתנו קשר ב 915-850-0900 .

אושר על ידי ד"ר אלכס Jimenez

לחצן התקשרות הירוק H. PNG

דיון בנושא נוסף: "כאבי גב חריפים

כאב גבזהו אחד הגורמים השכיחים ביותר לנכות וימי החמצה בעבודה ברחבי העולם. כאבי גב מייחסים את הסיבה השנייה בשכיחותה לביקורים במשרדי רופאים, שנמצאים במספרם רק בזיהומים בדרכי הנשימה העליונות. כ- 80 אחוז מהאוכלוסייה יחוו כאבי גב לפחות פעם אחת במהלך חייהם. עמוד השדרה הוא מבנה מורכב המורכב מעצמות, מפרקים, רצועות ושרירים, בין השאר רקמות רכות. מסיבה זו, פציעות ו / או מצבים מחמירים, כגון דיסקים, יכול בסופו של דבר להוביל לסימפטומים של כאבי גב. פציעות ספורט או פגיעות בתאונות דרכים הן לעיתים קרובות הגורם השכיח ביותר לכאבי גב, אולם לפעמים התנועות הפשוטות ביותר יכולות לגרום לתוצאות כואבות. למרבה המזל, אפשרויות טיפול אלטרנטיביות, כמו טיפול כירופרקטי, יכולות לעזור להקל על כאבי גב באמצעות התאמות בעמוד השדרה ומניפולציות ידניות, ובסופו של דבר לשפר את הקלה בכאב.

תמונה של הילד קריקטורה

EXTRA EXTRA | חשוב נושא: מומלץ אל Paso, TX Chiropractor

***

מה זה Sulforaphane?

מה זה Sulforaphane?

Sulforaphane הוא phytochemical, חומר בתוך קבוצת isothiocyanate של תרכובות organosulfur, שנמצאו ירקות cruciferous, כגון ברוקולי, כרוב, כרובית, וכרוב ניצנים. זה יכול להיות גם למצוא chok בוק, כרוב, collards, חרדל ירוק ו watercress. מחקרים הראו כי sulforaphane יכול לסייע במניעת סוגים שונים של סרטן על ידי הפעלת הייצור של Nrf2, או גורם גרעיני הקשור ל- erythroid 2, גורם תעתיק המווסת מנגנוני נוגדי חמצון מגנים השולטים בתגובת התא לחמצונים. מטרת המאמר הבא היא לתאר את תפקודו של סולפוראפן.

תַקצִיר

KEAP1-Nrf2-ARE נוגדי חמצון המערכת היא אמצעי העיקרי שבו תאים מגיבים ללחץ חמצוני ו xenobiotic. Sulforaphane (SFN), isothiocateate אלקטרופי המופק ירקות cruciferous, מפעיל את מסלול KEAP1-Nrf2-ARE והפך מולקולה של עניין בטיפול במחלות בהם מתח חמצוני כרוני משחק תפקיד אטיולוגי מרכזי. אנו מדגימים כאן כי המיטוכונדריה של בתרבית, פיגמנט רשתית אפיתל בתרבית, (RPE-1) תאים שטופלו SFN לעבור hyperfusion כי הוא עצמאי של שניהם Nrf2 ואת מעכב cytoplasmic KEAP1. מיטוכונדריאלי היתוך כבר דיווחו להיות cytoprotective על ידי עיכוב היווצרות הנקבוביות במיטוכונדריה במהלך אפופטוזיס, ועקבית עם זה, אנו מציגים Nrf2 עצמאית, cytoprotection של תאים שטופלו SFN חשופים אפופטוזיס, inducer, staurosporine. מבחינה מכנית, SFN מקטין את גיוס ו / או שימור של גורם ביקוע מסיס Drp1 למיטוכונדריה ו peroxisomes אבל אינו משפיע על שפע Drp1 הכוללת. נתונים אלה מראים כי התכונות המועילות של SFN מתרחבות מעבר להפעלת מערכת KEAP1-Nrf2-ARE ומצדיקות חקירה נוספת, בהתחשב בשימוש הנוכחי של הסוכן בניסויים קליניים מרובים.

מילות מפתח: Sulforaphane, Nrf2, Drp1, מיטוכונדריה, ביקוע, היתוך, אפופטוזיס

מבוא

Sulforaphane הוא מעכב Nrf2 עצמאי של ביקוע מיטוכונדריאלי

Sulforaphane (SFN) הוא מתחם isothiocyanate נגזר בתזונה הנפוצה ביותר מן ירקות cruciferous [56]. היא נוצרת בצמחים כתגובה קסנוביוטית לטריפה באמצעות שחרור שלפוחית ​​של מירוזינאז הידרוליטי של אנזים מתאים פגומים; אנזים זה ממיר glucosinolates כדי isothiocyantes [42]. במהלך שני העשורים האחרונים, SFN מאופיין בהרחבה על תכונות האנטי סרטניות, האנטי-אוקסידנטיות והמיקרוביאליות שלו (57). חלק ניכר מיעילות זו יוחס ליכולת של SFN כדי לווסת את נתיב איתות התגובה KEAP1-Nrf2-Nrf29-NRf2, למרות שפעולות נוספות של המתחם זוהו, כולל עיכוב פעילות של היסטון דקסטילז והתפתחות מחזור התא [ 3]. Nrf1 הוא גורם השעתוק נוגדי החמצון הראשי ובתנאים של הומיאוסטזיס, יציבותו מדוכאת באמצעות הפעולה של Cullin20KEAP2 ubiquitin ligase [3]. באופן ספציפי, Nrf1 הוא גויס את Cullin1KEAP2 ligase על ידי מחייב את מתאם המצע דימריק KEAP15 ו הוא שונה לאחר מכן עם שרשראות polyUb כי היעד גורם שעתוק עבור השפלה מתווך proteasome. המחזור הקונסטרוקטיבי הזה מגביל את מחצית החיים של Nrf30 בתאים לא מסודרים ל- 33 דק '[46], [55], [1], [151]. בתגובה לסוגים רבים של לחץ, בעיקר מתח חמצוני, KEAP1, חלבון עשיר בסיסטאין, משמש כחישן חיישן, ושינוי חמצוני של ציסטאין קריטיים, במיוחד C2, של KEAP1 מפרק את Nrf3-KEAP2 מ- CUL8 ובכך מונע השפלה Nrf20 [ 55], [2], [151]. יש לציין, SFN, ואולי אחרים Nrf1 activators, לחקות את הלחץ החמצוני על ידי שינוי C21 של KEAP2 למשל [2]. ייצוב של Nrf19 מאפשר טרנסלוקציה שלה לגרעין שבו הוא גורם לביטוי של הסוללה של שלב II נוגדי חמצון ו detoxification גנים. Nrf16 נקשר אלמנטים נוגדי חמצון מקדם התגובה (ARE) של גנים היעד שלה דרך ההטרודימריזציה עם חלבונים המאפיה קטן [41]. מערכת זו מציגה תגובה דינמית ורגישה לחומרים נוגדי חמצון עקיפים כמו SFN, רדיקלים חופשיים המיוצרים על ידי המיטוכונדריה [XNUMX] או מקורות פיזיולוגיים אחרים של מתח חמצוני [XNUMX].

המיטוכונדריה הם אורגנים דינמיים, תת-תאיים המווסתים שורה של תפקודים תאיים הנעים בין ייצור ATP ומאגר סידן תאיים לבין רגולציה של ויסות ואפופטוזיס [13], [49]. המיטוכונדריה מייצגת גם את המקור העיקרי של מינים של חמצן תגובתי (ROS) בתוך התא. ראוי תקנה של תפקוד המיטוכונדריה ולכן יש צורך לייעל את הייצור ATP כדי לענות על הצרכים הסלולר בעת ובעונה אחת למזער את ההשפעות המזיקות של ייצור רדיקלי חופשי מוגזם. דרישה קריטית לאפנון דק של תפקוד המיטוכונדריה היא היכולת של המיטוכונדריה לתפקד באופן עצמאי כמכונות ביוכימיות וכחלק מרשת רחבה ומגיבה.

מורפולוגיה רשתית המיטוכונדריה ותפקוד נקבעים על ידי איזון מוסדר בין ביקוע היתוך. ביקוע מיטוכונדריאלי נדרש לתורשת בת הבת של המיטוכונדריה במהלך חלוקת התא [28], כמו גם להשפעה הסלקטיבית, האוטופאפית של המיטוכונדריה המופרזת או הפגומה, שנקראת mitophagy [1]. לעומת זאת, היתוך נדרש עבור השלמת של הגנום המיטוכונדריה ושיתוף של רכיבי שרשרת האלקטרון תחבורה בין המיטוכונדריה השכנה [54]. ברמה המולקולרית, ביקוע המיטוכונדריאלי היתוך מוסדרים על ידי GTPases גדול, דמוי דינמי. שלושה אנזימים בעיקר מסדירים פיוז'ן: Mitnusins ​​1 ו- 2 (Mfn1 / 2) הם שני חלבונים ממברניים חיצוניים המווכים את היתוך הממברנה החיצונית באמצעות אינטראקציות הטרוטיפיות בין המיטוכונדריה הסמוכה [15], [25], [37], בעוד ש- OPA1 הוא פנימי חלבון הממברנה בו זמנית מבטיח קישוריות מטריצה ​​על ידי ויסות ריתוך של ממברנות פנימיות [5]. פעילות ה- GTPase של כל שלושת החלבונים נדרשת עבור היתוך חזק [5], [18], ו- OPA1 מוסדר עוד יותר על ידי פרוטאוליזה מורכבת בתוך הממברנה הפנימית המיטוכונדריה על ידי הפרוטאזות OMA1 [14], PARL [6] ו- YME1L [45 ]. חשוב לציין, פוטנציאל קרום מיטוכונדריה שלם נדרש פיוז 'ן יעיל על מנת לדכא את האינטגרציה של המיטוכונדריה פגום ובריא [26].

מיטוכונדריאלי ביקוע הוא בעיקר catalyzed על ידי חלבון cytosolic הנקרא Dynamin הקשורים חלבון 1 (Drp1 / DNM1L). Drp1 הוא גויס מן cytosol לאתרים פוטנציאליים של ביקוע על הממברנה החיצונית המיטוכונדריה [43]. הקולטנים העיקריים עבור Drp1 על הממברנה החיצונית הם גורם הביקוע המיטוכונדריה (Mff) [32] ובמידה פחותה יותר, ביקוע 1 (Fis1) [51]. בנוסף, קולטן דמה, MIEF1 / MiD51, התגלה כי פועל להגביל עוד יותר את הפעילות של חלבון Drp1 באתרי ביקוע פוטנציאליים [58]. לאחר מעוגן בקרום החיצוני המיטוכונדריה, Drp1 oligomerizes לתוך מבנים דמויי ספירלה סביב הגוף של המיטוכונדריה ולאחר מכן מנצל את האנרגיה הנגזרת GTP hydrolysis לתווך scission הפיזי של הממברנות החיצוניות והמיטוכונדריאלי [17]. Endoplasmic reticulum- tubules הנגזרים לפעול כמחילה הראשונית של המיטוכונדריה לפני oligomerization Drp1, מדגיש את ההתגלות כי מיטוכונדריה לא מכווצים רחבים יותר מאשר היקף מתירנית של ספירלה Drp1 הושלמה [12]. אקטין הדינמיקה גם חשוב עבור ER- המיטוכונדריה אינטראקציות שקודמים ביקוע המיטוכונדריה [24]. בנוסף לתפקידה ב ביקוע המיטוכונדריה, Drp1 מזרז את ביקוע של peroxisomes [40].

Drp1 דומה מאוד לחלבון הדינמין המאופיין היטב בכך ששני החלבונים מכילים תחום GTPase מסוף N, תחום ביניים קריטי לאוליגומיזציה עצמית, ומנגנון C-Terminal GTPase של מסוף C [31]. Drp1 משיגה סלקטיביות עבור ממברנות המיטוכונדריה באמצעות שילוב של אינטראקציות עם חלבונים קולטן Mff ו Fis1 וגם דרך זיקה שלה עבור cardiolipin phospholipid ספציפי המיטוכונדריה דרך ייחודי B- הוספת תחום של Drp1 [2]. Drp1 בדרך כלל קיים כמו homotetramer ב cytoplasm, ואת הרכבה סדר גבוה יותר באתרי ביקוע המיטוכונדריה מתווכת על ידי התחום התיכון של Drp1 [3].

בהינתן הקישור המרומז בין תפקוד המיטוכונדריה לבין מסלול KEAP1-Nrf2-ARE, בדקנו את ההשפעות של הפעלת Nrf2 על המבנה והפונקציה המיטוכונדריאלית. אנו מדגימים כאן כי SFN גורם מיטוכונדריה hyperfusion זה, באופן בלתי צפוי, הוא עצמאי הן Nrf2 ו KEAP1. השפעה זו של SFN היא באמצעות עיכוב של הפונקציה Drp1. אנו מראים עוד כי SFN מעניק התנגדות אפופטוזיס כי הוא Nrf2 עצמאית לחקות כי נצפתה תאים מדולדלת של Drp1. נתונים אלה מצביעים באופן קולקטיבי כי בנוסף לייצוב והפעלת Nrf2, SFN מודולציה של הדינמיקה המיטוכונדריאלית ומשמרת כושר התאוששות והישרדות.

תוצאות

הזרקת נוזלים

במהלך לימוד ההשפעות של הפעלת Nrf2 על דינמיקת הרשת המיטוכונדריאלית, גילינו שטיפול בתאי אפיתל פיגמנט אנושי (RPE-1) מונצח עם sulforaphane (SFN), מפעיל חזק של איתות Nrf2, גרם להתמזגות חזקה של רשת המיטוכונדריה בהשוואה לתאי בקרה שטופלו ברכב (איור 1 א 'וב'). המורפולוגיה של המיטוכונדריה בתאים אלה דמתה מאוד לזו של המיטוכונדריה בתאים המדוללת על ידי siRNA של Drp1 האנדוגני, גורם הביקוע המיטוכונדריאלי העיקרי (איור 1 א). תוצאה זו העלתה את הרעיון המסקרן לפיה ביקוע ומיטוזיה של המיטוכונדריה מגיב ישירות לרמות Nrf2 בתא. עם זאת, גירוי של תאים עם מייצבים ומפעילי Nrf2 אחרים כגון מעכב הפרוטאזום MG132, ה- tBHQ הפרו-אוקסידנט או מציאה של מעכב Nrf2 KEAP1 לא גרם להתמזגות מיטוכונדריאלית (איור 1 א 'ו- B). ייצוב Nrf2 על ידי מניפולציות אלה אושר על ידי סופג מערבי ל- Nrf2 אנדוגני (איור 1 ג). יתר על כן, ביטוי של Nrf2 היה ניתן לביטול עבור היתוך המיטוכונדריה המושרה על ידי SFN, שכן מציאה של Nrf2 אנדוגני עם siRNA לא הצליחה להתנגד לפנוטיפ זה (איור 1DF). מכיוון ש- SFN מגרה את המסלול KEAP1-Nrf2-ARE על ידי שינוי קוולנטי של שאריות ציסטאין של KEAP1 [21], דפקנו את KEAP1 בכדי לטפל אם היפרפוזיה של המיטוכונדריה המושרה על ידי SFN מגורה דרך מסלול תלוי ב- KEAP1, אך בלתי תלוי ב- Nrf2. עם זאת, דלדול KEAP1 לא הצליח לבטל היתוך מיטוכונדריאלי המושרה על ידי SFN (איור 1G I). למעשה, SFN הפך את המורפולוגיה הפרו-ביקוע הנגרמת על ידי דלדול KEAP1 (איור 1G, לוח ב לעומת לוח d). תוצאות אלו מצביעות על כך שטיפול ב- SFN גורם לאיחוי מיטוכונדריאלי ללא תלות במסלול KEAP1-Nrf2-ARE הקנוני והביא אותנו לחקור האם SFN משפיע ישירות על רכיבי מכונת הביקוע או היתוך המיטוכונדריה.

איור 1 SFN גורם Nrf2 / KEAP1- היתוך המיטוכונדריה עצמאית. (א) תאי RPE-1 הועברו עם siRNAs שצוינו וכעבור 3 ימים טופלו ב- DMSO או במפעילי ה- Nrf2 SFN (50 M M), MG132 (10 M M) או ב- tBHQ (100 M M) במשך 4 שעות. מיטוכונדריה (אדומה) מסומנת בנוגדן אנטי-טומ 20, וגרעינים (כחולים) מוכתמים נגד DAPI. (ב) גרף המציג כימות של ניקוד מורפולוגיה מיטוכונדריאלית מ (A). > 50 תאים למצב הוערכו בצורה מסונוורת. (ג) כתמים מערביים מייצגים מ (א). (ד) RPE-1 תאים הועברו transfected עם 10 ננומטר siRNA וכעבור 3 ימים טופלו ב- SFN במשך 4 שעות לפני שתוקנו ומוכתמים כמו ב- (A). (ה) גרף המציג כימות של ניקוד פנוטיפ מיטוכונדריאלי מ (D). > 100 תאים למצב הוערכו בצורה מסונוורת. (F) כתמים מערביים מייצגים מ (D). (G) תאים הועברו וטופלו כמו ב- (D) עם siCON או siKEAP1. (H) תאים מ (G) הושגו כמו ב- (B) ו- (E) על בסיס מורפולוגיה מיטוכונדריאלית. (I) כתמים מערביים מייצגים מ- (G). הנתונים ב- (B), (E) ו- (H) נערכו משלושה ניסויים עצמאיים כל אחד והמשמעות הסטטיסטית נקבעה על ידי מבחן t של הסטודנט בעל שני הזנבות. פסי שגיאה משקפים +/- SD (לפרשנות הפניות לצבע באגדת איור זו, הקורא מופנה לגרסת האינטרנט של מאמר זה).

Sulforaphane פוגעת באיגוד המיטוכונדריאלי של Drp1

בהתבסס על הממצא כי טיפול ב- SFN גורם לייתר יתר של המיטוכונדריה, אנו מניחים שפנוטיפ זה הוא תוצאה של פעילות פיוז'ן מוגזמת או עיכוב בפעילות הביקוע. כדי להפלות בין שתי אפשרויות אלה, השווה את המורפולוגיה של peroxisomes בנוכחות והיעדר SFN. Peroxisomes דומים המיטוכונדריה בכך שהם אורגני דינמי את הצורה ואת אורך אשר נמצאים כל הזמן שטף [44]. פרקיזומים מכילים הן את Fis1 והן את Mff בממברנה החיצונית שלהם, וכתוצאה מכך, הם מטרות עבור ביקוע מתווך Drp1 [22], [23]. עם זאת, peroxisomes לא לנצל את מכונות היתוך של רשת המיטוכונדריה וכתוצאה מכך, לא לעבור פיוז 'ן [39]. במקום זאת, ביקוע peroxisomal מתנגד על ידי התארכות של peroxisomes הקיים באמצעות תוספת נובו של ממברנות וחלבונים [44]. בגלל peroxisomes חוסר Mfn1 / 2 ו OPA1, אנו בטוחים שאם SFN מפעיל את מנגנון היתוך ולא מעכב את מנגנון הביקוע, אורך peroxisome לא יושפע. בתאים שטופלו ברכב, פרוקסיזומים מתוחזקים כארוניים קצרות, עגולות, בורגיות (איור 2, לוחות b ו- d). עם זאת, טיפול SFN גדל אורך peroxisome על ידי ~ 2 לקפל לעומת תאים שליטה (איור 2, לוחות F ו- H). יתר על כן, רבים של peroxisomes היו צבט ליד המרכז, המציין פגם scission פוטנציאל (איור 2, לוח ח, ראשי חצים). כמו כן, peroxisomes בתאים transfected עם drp1 siRNA היו ארוכים באופן ארוך (איור 2, לוחות J ו- L), המאשר כי Drp1 נדרשת עבור ביקוע peroxisomal וטוען כי SFN- טיפול גורם המיטוכונדריה ו פנוטיפים פנוטיזומלי על ידי שיבוש מנגנון הביקוע.

איור 2 SFN גורם להארכה peroxisomal. (א) תאי RPE-1 הועברו עם 10 ננומטר מה- siRNA המצוין וכעבור 3 ימים טופלו ב- DMSO או 50 M M SFN במשך 4 שעות. Peroxisomes (ירוק) תויגו עם נוגדן אנטי PMP70, מיטוכונדריה עם MitoTracker (אדום), ו- DNA מוכתם כנגד DAPI. שיבוצים מוגדלים של פרוקסיזומים מוצגים בצד ימין (לוחות d, h ו- l) כדי להקל על ההדמיה של השינויים במורפולוגיה הנגרמים על ידי דלדול SFN ו- Drp1. ראשי חץ מדגישים נקודות התכווצות. (לפרשנות הפניות לצבע באגדת דמות זו, הקורא מופנה לגרסת האינטרנט של מאמר זה).

הבא קבענו כיצד SFN מגביל את פונקציית Drp1. האפשרויות כללו ירידה ברמות הביטוי, גיוס / שימור במיטוכונדריה, אוליגומריזציה או פעילות אנזימטית של ה- GTPase. גירעון בכל אחד מאלה יביא להפחתת ביקוע מיטוכונדריאלי ולעילוי יתר. לא זיהינו שינויים ניתנים לשחזור ברמות החלבון Drp1 לאחר הטיפול ב- SFN (איורים 1C ו- 3A), ולכן הסקנו כי SFN אינו משנה את יציבות ה- Drp1 או את הביטוי, בהתאמה ל- Drp1 בעל מחצית חיים של> 10 שעות [50] וטיפולי ה- SFN שלנו קצרים יותר. לאחר מכן, בדקנו האם SFN השפיע על גיוסו או שימורו של Drp1 למיטוכונדריה. מחקרי חלוקה הראו כי SFN גרם לאובדן Drp1 מהשבר המיטוכונדריאלי (איור 3 א, נתיבים 7 8 ואיור 3 ב). כפי שדווח בעבר [43], רק חלק קטן מ- Drp1 (~ 3%) קשור לרשת המיטוכונדריה בכל זמן נתון בתנאי מצב יציב, כאשר מרבית האנזים שוכן בציטופלזמה (איור 3 א ', נתיבים 5 8. ). נתוני חלוקה אלה אושרו באמצעות ניתוח שיתוף לוקליזציה אשר הראה ירידה של ~ 40% במוקדי Drp1 המנוקדים, המנוקדים במיטוכונדריה לאחר טיפול SFN (איור 3 ג 'ו- D). יחד, נתונים אלה מצביעים על כך שההיתוך המיטוכונדריה המושרה על ידי SFN נובע, לפחות באופן חלקי, מהקשר המוחלש של Drp1 עם המיטוכונדריה. הנתונים שלנו אינם מבחינים בין אם SFN מפריע לגיוס המיטוכונדריה לעומת החזקת המיטוכונדריה של Drp1, או שניהם, מכיוון שניתוח ה- Drp1 האנדוגני לא היה אפשרי להמחשה של ה- GTPase באמצעות מיקרוסקופ של תאים חיים.

איור 3 SFN גורם לאובדן Drp1 מן המיטוכונדריה. (א) שבירה תת-תאית של תאים RPE-1 לאחר 4 h של DMSO או SFN. תאי Lysates שלמים (WCL), גרעיני (Nuc), cytosolic (קיטו), שברים מיטוכונדריאלי (מיטו) גולמי נפתרו על ידי SDS-PAGE ועיבוד עבור סופג המערבי עם הנוגדנים המצוין. ההגירה של סמנים משקל מולקולרי מצוין בצד שמאל. (ב) גרפים מראה כימות densitometric של Drp1 בשברים שצוין מ (א). (C) תאים RPE-1 היו transfected עם 10 nM siCON או siDrp1 ו 3 ימים מטופלים מאוחר יותר עם DMSO או SFN עבור 4 ח. Drp1 (ירוק) היה דמיינו עם נוגדנים נגד drp1, המיטוכונדריה עם MitoTracker (אדום), ואת הגרעינים עם DAPI (כחול). (D) אוטומטיות שיתוף לוקליזציה ניתוח של האות Drp1 ו MitoTracker מ (ג). הנתונים ב- (B) ו- (D) נערכו מתוך ניסויים עצמאיים של 3 ו- 5, בהתאמה, והמשמעות הסטטיסטית נקבעה על-ידי מבחן t-tail של שני זנבות. ברים שגיאה משקפים +/- SD וכוכביות מציינים משמעות סטטיסטית. (עבור פרשנות של הפניות צבע באגדה זו דמות, הקורא הוא התייחס לגרסה האינטרנט של מאמר זה).

הגנה על סולפורפאן נגד אפופטוזיס המושרה על ידי סטאוארוספורין ללא תלות ב- Nrf2

עבודה קודמת הראתה כי ביקוע מיטוכונדריאלי מותר ביצירת נקבוביות בקרום המיטוכונדריה החיצוני שנוצר על ידי Bax / Bak במהלך אפופטוזיס [11]. הוכח כי Drp1 גויס באופן סלקטיבי למיטוכונדריה במהלך אפופטוזיס [11] ובהתאם לכך, נצפו המיטוכונדריה מקוטעת בשלב מוקדם של התהליך [27]. לעומת זאת, עיכוב ביקוע מיטוכונדריאלי נחשב כמעכב אפופטוזיס על ידי חסימת היווצרות נקבוביות הממברנה החיצונית המאפשרות שחרור ציטוכרום c [53]. בהתאם, היתוך גירוי של המיטוכונדריה מעכב את התקדמות האפופטוזיס הנגרמת על ידי תרכובות כולל סטאורוספורין (STS) [14]. כדי לקבוע אם SFN מגן על תאי RPE-1 מפני אפופטוזיס בתיווך STS, ואם כן, האם הדבר דורש Nrf2, הקמנו assay כדי לגרום בקלות למחשוף פולי פולימראז ADP ריבוז (PARP), מצע של קספאז -3 מופעל וסמן סופי של אפופטוזיס. טיפול בתאי RPE-1 עם STM של 1M במשך 6 שעות גרם רק למחשוף צנוע מאוד של PARP, אולם זה נמנע על ידי טיפול משותף ב- SFN (למשל, איור 4 א, מסלול 3 לעומת 4). כדי להגדיל את החוסן של assay זה, רגישנו עוד יותר תאים לאפופטוזיס המושרה על ידי STS על ידי טיפול מקדים בהם ב- siRNA המכוון לגורם האנטי-אפופטוטי, Bcl-XL. טיפול מקדים זה הפחית את הביטוי של Bcl-XL וקידם באופן ניכר את מחשוף PARP כפונקציה של זמן שנחשף ל- STS (איור 4B, השווה מסלול 2 לנתיבים 4 10). חשוב לציין, שעתיים של טיפול מקדים במחשוף PARP ממתן באמצעות SFN בתאים שנחשפו ל- STS (איור 2 ג ', נתיב 4 לעומת 3 ונתיב 4 לעומת 5). כמו כן, תאים שהתרוקנו באופן יציב מ- Nrf6 על ידי CRISPR / Cas2 הוגנו באופן דומה מפני רעילות STS על ידי טיפול מקדים ב- SFN (איור 9 ג, מסלול 4 לעומת 11 ונתיב 12 לעומת 13 ואיור 14 ד). הגנה זו נצפתה באמצעות מחשוף PARP (איור 4C ו- D) ומורפולוגיה תאית (איור 4E) כקריאות. היעילות של דלדול Nrf4 על ידי CRISPR / Cas2 אושרה על ידי סופג מערבי (איור 9C, כתם Nrf4). כצפוי, דלדול תאים של Drp2, שמניב גם פנוטיפ של הזעת יתר (איור 1 א), חסם גם מחשוף PARP בתגובה ל- STS בהשוואה לתאי בקרה שהודגרו ב- SFN (איור 1F ו- G). יחד, ממצאים אלה עולים בקנה אחד עם SFN המעניק הגנה מפני אפופטוזיס באמצעות יכולתו להגביל את תפקוד ה- Drp4, ללא תלות בייצוב והפעלה של Nrf1.

איור 4 ההשפעות הציטוטרוטקטיביות של SFN אינן תלויות בביטוי Nrf2 (A). תאי RPE-1 טופלו מראש ב- DMSO או 50 M M SFN במשך שעתיים לפני הטיפול ב- DMSO, 2? M staurosporine (STS), או 1? M etoposide במשך 50 שעות ועובד עבור סופג מערבי נגד PARP. (ב) תאים של RPE-1 הועברו עם 2.5 ננומטר siCON, 1 ננומטר siBcl-XL או 2.5 ננומטר siBcl-XL וכעבור 3 ימים טופלו ב- DMSO או ב- 1 M M STS במשך 2, 4 או 6 שעות. כתמים מערביים מייצגים מוצגים ונדידת סמני משקל מולקולרי מסומנת משמאל. (ג) תאי wild-type שנוצרו על ידי CRISPR / Cas9 (Nrf2WT) ונוקאאוט Nrf2 (Nrf2KO) RPE-1 הועברו באמצעות 1 nM siBcl-XL וכעבור 3 ימים טופלו מראש ב- DMSO או 50 M M SFN למשך 2 שעות. . לאחר מכן, התאים טופלו ב- 1 M M STS במשך 2, 4 או 6 שעות. כתמים מערביים מייצגים עם הנוגדנים המצוינים מוצגים. (ד) כימות של PARP מבוקע כאחוז מסך PARP (ביקוע + לא מבוקר) משלושה ניסויים עצמאיים. חשוב לציין, כי רמות ה- PARP הניתנות היו דומות בין אם התאים ביטאו Nrf3 ובין אם לאו, דבר המצביע על כך שההגנה על SFN מפני STS אינה תלויה בגורם השעתוק. (ה) תמונות X בניגוד שלב שלב שצולמו מיד לפני הקציר של lysates מ (C). סרגל קנה מידה = 2 מ '. (F) כתמים מערביים מייצגים המראים כי דלדול של Drp20 מעניק הגנה כמעט דומה להשגת STS כטיפול SFN. תאי RPE-65 הועברו עם 1 ננומטר siBcl-XL והועברו בנוסף עם 1 ננומטר siCON או 1 ננומטר siDrp10. 10 ימים לאחר מכן, תאי siCON טופלו מראש ב- SFN כמו ב- (A) ו- (C) ואז נחשפו ל- STS במשך 1 שעות לפני שנקטפו ועובדו לצורך סופג מערבי עם הנוגדנים שצוינו. (G) זהה ל- (D) עבור הנתונים שהוצגו ב- (F) שהורכבו משלושה ניסויים עצמאיים. פסי שגיאה משקפים +/- SEM

דיון

גילינו כי SFN מודולציה של ביקוע המיטוכונדריה / דינמי היתוך עצמאי של השפעותיו על מסלול KEAP1-Nrf2-ARE. זה מסקרן בגלל הקשר ההנחה בין תפקוד המיטוכונדריאלי לייצור ROS ואת הצורך של squelching המיטוכונדריה הנגזרות רדיקלים באמצעות הפעלה של Nrf2. ההשפעה הפונקציונלית הנוספת של SFN הינה בעלת חשיבות פוטנציאלית בהתחשב בניסויים הקליניים של 30 אשר נמצאים כעת בבדיקת SFN לטיפול במגוון מחלות כולל סרטן ערמונית, מחלת ריאות חסימתית ומחלת תאי מגל [7], [10], [ 47].

כי SFN הוא isothiocyanate [56] והיא מפעילה איתות Nrf2 על ידי acylating קריטי CEAP1 קריטיים כדי לדכא השפלה Nrf2 [21], נובע מכך SFN מפעילה את ההשפעות הפרו-פיוז'ן שלה על ידי מווסת את הפעילות של ביקוע או גורם היתוך באמצעות שינוי ציסטאין . הנתונים שלנו תומכים מאוד Drp1 להיות מוסדר שלילי על ידי SFN אם כי אם GTPase הוא יעד ישיר של acylation נשאר להבהיר. למרות פער הידע הזה, הפונקציה של Drp1 מתבטאת בבירור על ידי SFN, שכן שני המיטוכונדריה וה- peroxisomes הופכים ל hyperfused בתגובה לטיפול ב- SFN, ואלו הארגנים חולקים את Drp1 לאירועי scission שלהם [38]. בנוסף, SFN מקטין את כמות Drp1 כי localizes ו מצטבר במיטוכונדריה (איור 3). 3). בגלל הניסויים שלנו נעשו עם כל החלבונים האנדוגניים, זיהוי שלנו של Drp1 באתרי הביקוע המיטוכונדריאלי הוא בתנאים של מצב יציב, וכתוצאה מכך, אנחנו לא יכולים להבחין בין גיוס לעומת פגם שימור של האנזים שנגרם על ידי SFN. יתר על כן, אנחנו לא יכולים לחסל את האפשרות כי SFN acylates קולטן במיטוכונדריה (Fis1 או Mff) לחסום גיוס Drp1 עדיין, אנו חושדים כי Drp1 הוא שונה ישירות. Drp1 יש תשע ציסטאין, שמונה מהם מתגוררים בתוך התחום התיכון הנדרש עבור oligomerization [3], ואחד מהם מתגורר ב- GTPase Effector Domain (GED) ב C- הטרמינל של Drp1. Acylation ישיר של כל אלה ציסטאין עלול לגרום לליקוי פעילות Drp1 ולכן לבסס את ההשפעה של SFN על הדינמיקה המיטוכונדריאלי. יש לציין כי עבודה קודמת מצביעה על כך שליקויים באוליגומריזציה ופעילות קטליטית יכולים לבטל את החזקתה של Drp1 במיטוכונדריה [52]. Cys644 בתחום GED הוא יעד אטרקטיבי במיוחד המבוסס על עבודה קודמת מראה כי מוטציה של מוטציות phenocopies ציסטאין זה הפוגע בפעילות Drp1 GTPase [4] וכי זה ציסטאין מסוים הוא שונה על ידי electroiles thiol- תגובתי [9]. החלטה של ​​שאלה זו מצטיינים ידרוש אימות ספקטרומטרית מסה.בסיכום, זיהינו רומן, פונקציה cytoprotective עבור SFN המתחם קלינית רלוונטית. בנוסף להפעלת מאסטר אנטי oxidant גורם שעתוק Nrf2, SFN מקדם מיטוכונדריה ו היתוך peroxisomal, ואת האפקט הזה הוא עצמאי של Nrf2. המנגנון המונח ביסודו של התופעה כרוך בהקטנת תפקוד ה- GTPase Drp1, המתווך העיקרי של ביקוע המיטוכונדריה והבקוע הפרוקסומלי. אחת התוצאות העיקריות של היתוך המיטוכונדריאלי של SFN בתיווך היא שהתאים הופכים להיות עמידים בפני ההשפעות הרעילות של staurosporine של אפופטוזיס. פעולה זו נוספת cytoprotective של SFN יכול להיות כלי קליני מסוים של מחלות נוירודגנרטיבים רבים אשר לגיל הוא גורם הסיכון המוביל (למשל, מחלת פרקינסון, מחלת אלצהיימר, ניוון מקולרי הקשורים לגיל), כמו אלה מחלות נקשרו עם אפופטוזיס ו מופחת רמות ו / או dysregulation של Nrf2 [35], [36], [48].

חומרים ושיטות

אפופטוזיס מבחני

תאים נזרעו והועברו באמצעות siRNA כמפורט להלן. התאים טופלו מראש ב- 50 M M sulforaphane למשך שעתיים כדי לגרום לאיחוי מיטוכונדריאלי ואז טופלו ב- 2 M staurosporine כדי לגרום לאפופטוזיס. בזמן הקציר, התקשורת נאספה בצינורות בודדים ונתונה לצנטריפוגה במהירות גבוהה לתאי אפופטוטיים גלולה. גלולה תאית זו שולבה עם תאים חסידים ופורקה במאגר Laemmli מרוכז פי 1. דוגמאות סופחו סופג מערבי נגד PARP.

CRISPR / Cas9 דור הבניה

כדי ליצור LentiCRISPR / eCas9 1.1, LentiCRISPR v2 (addgene #52961) היה לחתוך הראשון עם Age1 ו BamH1. לאחר מכן, SpCas9 מ 9 (ADGEN #1.1) היה PCR מוגבר עם age71814 ו BamH1 overhangs באמצעות פריימרים הבאים (קדימה AGCGCACCGGTTCTAGAGCGCTGCCACCATGGACTATAAGGACCACGAC, הפוך AAGCGCGGATCCCTTTTTTTTTTTTGTTGGTGGGGG) ו ligated לתוך וקטור לחתוך לעיל. sgRNA רצפים נקבעו באמצעות Benchling.com. פרמטרים הוגדרו למקד את רצף הסימול עם הציונים הגבוהים ביותר על היעד והיעד הנמוך ביותר. רצפים הבאים (רצף מיקוד הדגיש, HS sgNFE1L2 # 2 תחושה CACCGCGACGGAAAGAGTATGAGC, antisense AAACGCTCATACTCTTTCCGTCGC; hs sgNFE1L2 # 2 תחושה CACCGGTTTCTGACTGGATGTGCT, AAACAGCACATCCAGTCAGAAACC antisense; hs sgNFE2L2 # 2 תחושה CACCGGAGTAGTTGGCAGATCCAC, antisense AAACGTGGATCTGCCAACTACTCC) היו מרותק ו ligated לתוך BsmB3 לחתוך LentiCRISPR / eCas1 9. Lentivirally נגוע בתאי RPE-1.1 נבחרו עם puromycin ומתוחזק כאוכלוסייה מאוכלס. נוקאוט אושרה על ידי immunofluorescence ו סופג המערבי.

תרבות תאים טרנסקציות

תאי אפיתל של פיגמנט הרשתית האנושי שהומרו בטלומראז (RPE-1) (ATCC) היו בתרבית במדיום הנשר המותאם של Dulbecco (DMEM) המכיל גלוקוז 1 גרם / ליטר בתוספת פניצילין, סטרפטומיצין, קוקטייל חומצה אמינית 1X לא חיוני (Life Technologies), ו 10% סרום שור עוברי (טכנולוגיות חיים). עבור transfections siRNA, 30,000 תאים / מ"ל ​​נזרעו בן לילה. התאים קיבלו 35,000 ננומטר siRNA מדולל ב- DMEM ללא סרום ובשילוב עם ריאגנט transfection של אינטרפרין 10% (PolyPlus). לצורך רגישות לאפופטוזיס, התאים קיבלו 0.3 ננומטר Bcl-XL siRNA. תאים נקצרו 1-2 ימים לאחר transfection.

כימיקלים, נוגדנים ואוליגוס siRNA

נוגדנים כנגד? -טובולין (איתות תאים),? -טובולין (סיגמא), Drp1 (BD Biosciences), KEAP1 (Proteintech), Lamin B1 (Abcam), PARP (איתות תאים), PMP70 (Abcam) ו- Tom20 (BD Biosciences) ) שימשו בדילול 1: 1000 לצורך כתם מערבי ולחיסון פלואורסצנטי. נוגדן ארנבים פנימי ואנטי- Nrf2 שימש בשעה 1: 2000 לצורך סופג מערבי [34], [59]. Sulforaphane (Sigma) ו staurosporine (Tocris) שימשו ב 50? M ו 1? M בהתאמה. siRNAs נגד Drp1 (Dharmacon), Nrf2 (Dharmacon), KEAP1 (איתות תאים) ו- Bcl-XL (איתות תאים) שימשו ב -10 ננומטר, אלא אם כן צוין אחרת.

Immunofluorescence ו ב תיוג Vivo

תאים שנזרעו על כיסויי זכוכית בגודל 18 מ"מ טופלו ברכב או בתרופה, נקבעו בפורמלדהיד של 3.7% ואז הוחדרו ב- 0.2% טריטון X-100 / PBS על קרח למשך 10 דקות. נוגדנים ראשוניים הודגרו באלבומין בסרום שור 3% (BSA) ב- PBS למשך הלילה ב -4 CC. בעקבות שטיפות PBS, הודגרו התאים למשך שעה אחת בנוגדנים משניים הניתנים למין, Alexa1- או Alexa488-, מצומדות (מדולל 546: 1) ו- 1000 µg / mL DAPI (Sigma) ב- 0.1% BSA / PBS. המיטוכונדריה הוצגה באמצעות דמוי חיסון אנטי-טומ 3 או באמצעות דגירת תאים ב- 20 ננומטר MitoTracker אדום CMXRos (Molecular Probes, Inc.) ב- DMEM ללא סרום למשך 200 דקות בטמפרטורה של 30 מעלות צלזיוס לפני הקיבוע.

מיקרוסקופיה וניתוח תמונה

דגימות אימונופלואורסצנטיות נצפו במיקרוסקופ קונפוקלי LSM710 (קרל זיס). צילומי המיקרו תפסו באמצעות מטרות טבילה בשמן 63X או 100X ותמונות שהותאמו ושופרו באמצעות Adobe Photoshop CS6. ניתוח שיתוף לוקליזציה בוצע באמצעות Carl Zeiss LSM710 שיתוף לוקליזציה תכונה עם ספים שנקבעו באופן ידני תוך עיוור לזהות הדגימות. פסי קנה מידה לכל אורכו, אלא אם כן צוין אחרת, הם 10 מטר. מורפולוגיה מיטוכונדריאלית הוערכה על ידי ניקוד עיוור. אם המיטוכונדריה של התא נשמרה כנקודה מרובה, עגולה ומופלית, התא הושג כ'בקעה '. אם לא ניתן היה להבדיל בין המיטוכונדריה האישית וכל רשת המיטוכונדריה נראתה רציפה, התא הושג כ'התמזגות '. כל שאר התאים, כולל אלה עם המיטוכונדריה מקובצים, זכו לציון "ביניים".

חלוקה תת-תאית

תאי RPE-1 גודלו למפגש. בעקבות שטיפת PBS, התאים הועברו לצנטריפוגה ב 600 גרם למשך 10 דקות והושעו מחדש במאגר בידוד 600 ליטר (210 מ"מ מניטול, 70 מ"מ סוכרוז, 5 מ"מ MOPS, 1 מ"מ EDTA pH 7.4 + 1 מ"מ PMSF). ההשעיה הוזרה 30 פעמים במכשיר הומוגניזציה של Dounce. חלק מההומוגנייט נשמר כ- lysate של תאים שלמים. השאר היה נתון לצנטריפוגה ב 800 גרם למשך 10 דקות לגרעיני גלולה. Supernatants הועברו צנטריפוגה ב 1500 גרם במשך 10 דקות כדי לנקות את הגרעינים הנותרים ואת התאים unlysed. תגובת שיקוע זו עברה צנטריפוגה ב 15,000 גרם במשך 15 דקות לגלולה של המיטוכונדריה. תגובת שיקוע הטבעית נשמרה כשבר ה"ציטוזולי ". הגלולה נשטפה בעדינות עם PBS והושעה מחדש במאגר בידוד. ריכוז החלבון של כל שבר נמדד על ידי בדיקת חומצה דו-סינכונינית (BCA) וכמויות שוות של חלבון נפתרו על ידי SDS-PAGE.

המערבי סופג

תאים נשטפו ב- PBS והופתרו במאגר סולביזציה של Laemmli פעמיים (2 מ"מ טריס [pH 100], 6.8% SDS, 2% כחול ברומופנול, 0.008% 2-mercaptoethanol, 2% גליצרול ו- 26.3% Pyrinin Y). Lysates היו מבושלים במשך 0.001 דקות לפני הטעינה על ג'לים polyacrylamide נתרן dodecyl סולפט (SDS). חלבונים הועברו לקרומי ניטרוצלולוזה והקרומים נחסמו למשך שעה בשעה 5% חלב / TBST. נוגדנים ראשוניים דוללו בחלב / TBST של 1% והודגרו עם הכתם בן לילה ב -5 CC. נוגדנים משניים מצומדים חזרת (HRP) מדוללים בחלב 5% / TBST. כתמים עובדו עם כימילומינסנציה משופרת, וכימות צפיפות מבוצע באמצעות תוכנת ImageJ.

ד"ר חימנז לבן מעיל

Sulforaphane הוא כימיקל מאוסף isothiocyanate של חומרים organosulfur המתקבל ירקות cruciferous, כולל ברוקולי, כרוב, כרובית, כרוב, collards, בין היתר. Sulforaphane מיוצר כאשר myrosinase האנזים הופך glucoraphanin, glucosinolate, לתוך sulforaphane, הידוע גם בשם sulforaphane-glucosinolate. נבטי ברוקולי וכרובית יש את הריכוז הגבוה ביותר של glucoraphanin או מבשר sulforaphane. מחקרים הראו כי sulforaphane משפר את יכולתו של הגוף האנושי נוגדי חמצון כדי למנוע בעיות בריאותיות שונות. ד"ר אלכס Jimenez DC, תובנה CCST

Sulforaphane והשפעותיו על סרטן, תמותה, הזדקנות, מוח והתנהגות, מחלות לב ועוד

Isothiocyanates הם כמה תרכובות צמח החשוב ביותר שאתה יכול לקבל בתזונה. בסרטון זה אני עושה את המקרה המקיף ביותר עבור אותם כי היה אי פעם. טווח קשב קצר? דלג לנושא המועדף עליך על ידי לחיצה על אחת מנקודות הזמן הבאות. ציר זמן מלא להלן.

מקטעי מפתח:

  • 00: 01 - סרטן ותמותה
  • 00: 19 - הזדקנות
  • 00: 26: 30 - המוח וההתנהגות
  • 00: 38 - סיכום סופי
  • 00: 40 - מינון

ציר זמן מלא:

  • 00: 00: 34 - מבוא של sulforaphane, מוקד עיקרי של הסרטון.
  • 00: 01: 14 - הצריכה של הצומח הצמח והפחתת בתמותה מכל הסיבות.
  • 00: 02 - סיכון לסרטן הערמונית.
  • 00: 02 - סיכון לסרטן שלפוחית ​​השתן.
  • 00: 02 - סרטן הריאה אצל מעשנים מסתכן.
  • 00: 02 - סיכון לסרטן השד.
  • 00: Hypothetical: מה אם כבר יש לך סרטן? (התערבות)
  • 00: 03: 35 - מנגנון מתקבל על הדעת המניע את הנתונים התמותה הסרטן ותמותה.
  • 00: 04 - Sulforaphane וסרטן.
  • 00: 05: 32 - ראיות לבעלי חיים המראים השפעה חזקה של ברוקולי לנבוט לחלץ על התפתחות שלפוחית ​​השתן בעכברים.
  • 00: 06 - השפעת תוסף ישיר של sulforaphane בחולי סרטן הערמונית.
  • 00: 07: 09 - ביואקומולציה של מטבוליטים איסוציאיאנט ברקמת השד בפועל.
  • 00: 08: 32 - עיכוב של תאי גזע סרטן השד.
  • 00: 08: 53 - שיעור היסטוריה: brassicas הוקמו כבעלי תכונות בריאותיות גם ברומא העתיקה.
  • 00: 09 - היכולת של Sulforaphane כדי לשפר את הפרשת מסרטן (בנזין, acrolein).
  • 00: 09 - NRF51 כמתג גנטי באמצעות רכיבי תגובה נוגדי חמצון.
  • 00: 10 - כיצד NRF10 ההפעלה משפר הפרשת מסרטן באמצעות גלוטתיון- S-conjugates.
  • 00: 10: 34 - נבטים בריסל להגדיל גלוטתיון- S-transferase ולהפחית נזק ל- DNA.
  • 00: 11 - ברוקולי לנבוט משקה מגביר הפרשת בנזין על ידי 20%.
  • 00: 13: 31 - ברוקולי לנבוט homogenate מגביר אנזימים נוגדי חמצון בדרכי הנשימה העליונות.
  • 00: 15: צריכת הצליבה הצמחית ותמותה ממחלות לב.
  • 00: 16 - ברוקולי נובט אבקת משפר את רמת השומנים בדם ואת הסיכון למחלות לב כל סוג של חולי סוכרת מסוג 55.
  • 00: 19 - תחילת סעיף ההזדקנות.
  • 00: 19 - דיאטה עשירה ב- Sulforaphane משפרת תוחלת חיים של חיפושיות מ- 21 ל- 15% (בתנאים מסוימים).
  • 00: 20 - חשיבותה של דלקת נמוכה לאריכות ימים.
  • 00: 22: CROCiferous ירקות ברוקולי נבט אבקה נראה להקטין מגוון רחב של סמנים דלקתיים בבני אדם.
  • 00: 23: 40 - סיכום וידאו: סרטן, קטעים מזדקנים
  • 00: 24: 14 - מחקרים שנעשו על ידי עכברים מצביעים על כך ש- sulforaphane עשוי לשפר את תפקוד המערכת החיסונית הזקנה בגיל מבוגר.
  • 00: 25 - שיפור צבע השיער גדל במודל עכבר של מקריח. תמונה ב 18: 00: 26.
  • 00: 26 - התחלה של המוח והתנהגות סעיף.
  • 00: 27: 18 - השפעת ברוקולי לנבוט לחלץ על אוטיזם.
  • 00: 27: 48 - השפעת glucoraphanin על סכיזופרניה.
  • 00: 28: 17 - תחילת הדיון בדיכאון (מנגנון ומחקרים סבירים).
  • 00: 31 - מחקר עכבר באמצעות 21 דגמים שונים של לחץ המושרה על-ידי דיכאון הראה sulforaphane ביעילות דומה כמו fluoxetine (prozac).
  • 00: 32: 00 - מחקר מראה בליעה ישירה של glucoraphanin בעכברים הוא יעיל באופן דומה במניעת דיכאון מ תבוסה חברתית מודל הלחץ.
  • 00: 33 - תחילתו של קטע neurodegeneration.
  • 00: 33 - Sulforaphane ואלצהיימר.
  • 00: 33 - Sulforaphane ומחלת פרקינסון.
  • 00: 33 - Sulforaphane והונגטינגטון.
  • 00: 34: 13 - Sulforaphane מגביר את החלבונים בהלם חום.
  • 00: 34 - תחילתו של סעיף פגיעה מוחית טראומטית.
  • 00: 35: 01 - Sulforaphane מוזרק מיד לאחר TBI משפר זיכרון (מחקר העכבר).
  • 00: 35: 55 - Sulforaphane ופלסטיות עצבית.
  • 00: 36: 32 - Sulforaphane משפר את הלמידה במודל של סוכרת מסוג II בעכברים.
  • 00: 37: 19 - Sulforaphane ו Duchenne ניוון שרירים.
  • 00: 37: עיכוב מיוסטטין בתאי לווין שרירים (במבחנה).
  • 00 - 38: 06: סיבת וידאו מאוחרת: תמותה וסרטן, נזק ל- DNA, מתח חמצוני ודלקת, הפרשת בנזן, מחלות לב וכלי דם, סוכרת מסוג II, השפעות על המוח (דיכאון, אוטיזם, סכיזופרניה, ניוון מוחי), נתיב NRF2.
  • 00: 40 - מחשבות על חישוב מנה של נבטי ברוקולי או sulforaphane.
  • 00: 41: אנקדוטות על הנבטה בבית.
  • 00: על טמפרטורת בישול ופעילות sulforaphane.
  • 00: 43: 45 - חיידקי הבטן המרה של sulforaphane מ glucoraphanin.
  • 00: 44 - תוספי מזון טובים יותר בשילוב עם מירוזינאז פעיל מירקות.
  • 00: 44 - טכניקות בישול וירקות cruciferous.
  • 00: 46 - Isothiocyanates כמו goitrogens.

תודות

Sciencedirect.com/science/article/pii/S2213231716302750

איך הוא Sulforaphane מיוצר?

חימום מפחית את פעילות החלבון Epitiospecifier ומגביר את תצורת Sulforaphane בברוקולי

תַקצִיר

סולפוראפאן, איזותיוציאנט מברוקולי, הוא אחד החומרים החומרים המסרטנים החזקים ביותר שמקורם במזון. תרכובת זו אינה קיימת בירק השלם, אלא היא נוצרת ממבשר הגלוקוזינולאט שלה, גלוקוראפנין, על ידי פעולת המירוזינאז, אנזים תיוגלוקוזידאז, כאשר רקמת הברוקולי נמעכת או נלעסת. עם זאת, מספר מחקרים הוכיחו שתפוקת הסולפורפאן מגלוקוראפנין נמוכה, וכי אנלוג ניטריל לא ביואקטיבי, סולפורפן ניטריל, הוא מוצר ההידרוליזה העיקרי כאשר רקמת הצמח נמעכת בטמפרטורת החדר. עדויות עדכניות מצביעות על כך שבארבידופסיס, היווצרות ניטריל מגלוקוזינולטים נשלטת על ידי חלבון רגיש לחום, חלבון אפיתיוספייסר (ESP), גורם גורם לא-קטליטי של מירוזינאז. המטרות שלנו היו לבחון את ההשפעות של חימום פרחי ברוקולי ונבטים על היווצרות סולפורפאן וסולפורפאן ניטריל, כדי לקבוע אם ברוקולי מכיל פעילות ESP, ואז לתאם שינויים תלויי חום בפעילות ESP, תכולת סולפורפן וביו-אקטיביות, כפי שנמדד על ידי אינדוקציה של שלב II אנזים רעלים רעלים של קינון (QR) בתרבית תאים. חימום פרחי ברוקולי טריים או נבטי ברוקולי ל 60 מעלות צלזיוס לפני ההומוגניזציה הגביר במקביל את היווצרות הסולפורפאן וירידה ביצירת ניטריל הסולפורפן. הפסד משמעותי בפעילות ה- ESP מקביל לירידה ביצירת ניטריל הסולפורפני. חימום ל -70 מעלות צלזיוס ומעלה הוריד את היווצרות שני המוצרים בפרחי הברוקולי, אך לא בנבטי הברוקולי. האינדוקציה של QR בתאי hepatoma Hepa lclc7 של עכבר מתורבת מקבילה לעלייה ביצירת סולפורפאן.

 

חימום מראש של פרחי ברוקולי ונבטים ל -60 מעלות צלזיוס הגביר באופן משמעותי את היווצרות זרז הסולפורפן (SF) בתמציות רקמות ירקות לאחר ריסוק. זה היה קשור לירידות ביצירת סולפורפאן ניטריל (SF Nitrile) ופעילות חלבון epithiospecifier (ESP).

מילות מפתח: ברוקולי, Orolacea Brassica, Cruciferae, סרטן, Anticarcinogen, Sulforaphane, Sulforaphane ניטריל, חלבון Epithiospecifier, רדוקטאז Quinone

לסיכום, סולפוראפאן הוא חומר פיטוכימי המצוי בברוקולי, ובירקות מצליבים אחרים. כמות בלתי מבוקרת של חומרים מחמצנים הנגרמת על ידי גורמים פנימיים וחיצוניים כאחד עלולה לגרום למתח חמצוני בגוף האדם אשר עלול בסופו של דבר להוביל למגוון בעיות בריאותיות. Sulforaphane יכול להפעיל את הייצור של Nrf2, גורם שעתוק המסייע לווסת מנגנוני נוגדי חמצון מגנים השולטים בתגובת התא לחמצונים. היקף המידע שלנו מוגבל לבעיות בריאות כירופרקטיקה ובעמוד השדרה. כדי לדון בנושא, אל תהסס לשאול את ד"ר חימנז או ליצור איתנו קשר בכתובת 915-850-0900 .

אושר על ידי ד"ר אלכס Jimenez

הפניה מ: Sciencedirect.com

לחצן התקשרות הירוק H. PNG

דיון בנושא נוסף: "כאבי גב חריפים

כאב גבזהו אחד הגורמים השכיחים ביותר לנכות וימי החמצה בעבודה ברחבי העולם. כאבי גב מייחסים את הסיבה השנייה בשכיחותה לביקורים במשרדי רופאים, שנמצאים במספרם רק בזיהומים בדרכי הנשימה העליונות. כ- 80 אחוז מהאוכלוסייה יחוו כאבי גב לפחות פעם אחת במהלך חייהם. עמוד השדרה הוא מבנה מורכב המורכב מעצמות, מפרקים, רצועות ושרירים, בין השאר רקמות רכות. מסיבה זו, פציעות ו / או מצבים מחמירים, כגון דיסקים, יכול בסופו של דבר להוביל תסמינים של כאבי גב. פציעות ספורט או פציעות תאונות דרכים הם לעתים קרובות הגורם השכיח ביותר של כאבי גב, עם זאת, לפעמים הפשוטה ביותר של תנועות יכול להיות תוצאות כואבות. למרבה המזל, אפשרויות טיפול אלטרנטיביות, כגון טיפול כירופרקטי, יכולות לעזור להקל על כאבי גב באמצעות שימוש בהתאמות השדרה ומניפולציות ידניות, ובסופו של דבר משפרות את תחושת הכאב.

תמונה של הילד קריקטורה

EXTRA EXTRA | חשוב נושא: מומלץ אל Paso, TX Chiropractor

***

תפקיד מתפתח של Nrf2 ב פונקציה המיטוכונדריאלי

תפקיד מתפתח של Nrf2 ב פונקציה המיטוכונדריאלי

חמצון מיוצר בדרך כלל באופן מבוקר על מנת להסדיר תהליכים חיוניים בגוף האדם, כולל חלוקת התא, דלקת, תפקוד המערכת החיסונית, autophagy, ואת תגובת הלחץ. עם זאת, הייצור הבלתי מבוקרת של אלה חמצון יכול לתרום סטרס חמצונים, אשר עשוי להשפיע על הפונקציה הסלולרית, המוביל לפיתוח של רעילות, מחלות כרוניות וסרטן. מנגנוני ההגנה נוגדי החמצון של גוף האדם מוסדרים על ידי סדרה של מסלולים חיוניים השולטים בתגובה של התא לחמצון. הגורם הגרעיני erythroid 2 גורם הקשור, הידוע גם בשם Nrf2, הוא הרגולטור המתעוררים של התנגדות הסלולר לחמצון. מטרת המאמר להלן היא לדון ולהפגין את התפקיד המתעוררים של Nrf2 בתפקוד המיטוכונדריה.

תַקצִיר

גורם השעתוק NF-E2 p45 הקשור לגורם 2 (Nrf2; שם הגן NFE2L2) מאפשר הסתגלות והישרדות בתנאי לחץ על ידי ויסות הביטוי הגנטי של רשתות מגוונות של חלבונים ציטוטרופנטים, כולל אנזימים נוגדי חמצון, אנטי דלקתיים וניקוי רעלים. כחלבונים המסייעים בתיקון או בהסרת מקרומולקולות פגועות. ל- Nrf2 יש תפקיד מכריע בשמירה על הומאוסטזיס חמצוני של תאים על ידי ויסות הביוסינתזה, השימוש וההתחדשות של גלוטתיון, תיורודוקסין ו- NADPH ועל ידי שליטה בייצור מינים של חמצן תגובתי על ידי מיטוכונדריה ו- NADPH אוקסידאז. בתנאים הומאוסטטיים, Nrf2 משפיע על פוטנציאל הממברנה המיטוכונדריאלית, על חמצון חומצות השומן, על זמינות המצעים (NADH ו- FADH2 / succinate) לנשימה וסינתזת ATP. בתנאי לחץ או גירוי גורמי גדילה, הפעלת Nrf2 נוגדת את ייצור מינים של חמצן תגובתי מוגבר במיטוכונדריה באמצעות ויסות תעתיק של חלבון 3 ללא צימוד ומשפיע על ביוגנזה של המיטוכונדריה על ידי שמירה על רמות גורם נשימה גרעיני 1 וקולטן המופעל על ידי התפשטות חמצן? coactivator 1 ?, כמו גם על ידי קידום ביוסינתזה של נוקליאוטידים של פורין. מפעילי Nrf2 פרמקולוגיים, כגון הסולפוראפאן האיזותיוציאנט הטבעי, מעכבים פתיחה בתיווך חמצון של נקבוביות המעבר לחדירות המיטוכונדריה ונפיחות במיטוכונדריה. באופן מוזר, נמצא כי תרכובת 1,4-דיפניל -1,2,3-טריאזול סינטטית, שתוכננה במקור כמפעיל Nrf2, מקדמת מיטופגיה, ובכך תורמת להומאוסטזיס המיטוכונדריאלי הכולל. לפיכך, Nrf2 הוא שחקן בולט בתמיכה בשלמות המבנית והתפקודית של המיטוכונדריה, ותפקיד זה הוא קריטי במיוחד בתנאי לחץ.

מילות מפתח: Bioenergetics, Cytoprotection, Keap1, מיטוכונדריה, Nrf2, רדיקלים חופשיים

עיקרי הדברים

  • Nrf2 יש תפקיד מכריע בשמירה על הומאוסטזיס חיסונים הסלולר.
  • Nrf2 משפיע על פוטנציאל קרום המיטוכונדריה וסינתזת ה- ATP.
  • Nrf2 משפיע על חמצון חומצות השומן המיטוכונדריאלי.
  • Nrf2 תומך בשלמות המבנית ופונקציונלית של המיטוכונדריה.
  • Nrf2 activators יש השפעות מועילות כאשר הפונקציה המיטוכונדריה נפגעת.

מבוא

גורם השעתוק NF-E2 גורם הקשור ל- p45 2 (Nrf2; שם הגן NFE2L2) מווסת את הביטוי של רשתות של גנים המקודדים חלבונים עם פעילויות ציטוטרפקטוריות מגוונות. Nrf2 עצמו נשלט בעיקר ברמת יציבות החלבון. בתנאים בסיסיים, Nrf2 הוא חלבון קצר מועד אשר נתון לכל מקום מתמשך והשפלה פרוטאזומלית. ישנן שלוש מערכות ליגאזות של יוביקוויטין שתורמות להידרדרות Nrf2. מבחינה היסטורית, הווסת השלילי הראשון של Nrf2 שהתגלה היה חלבון 1 הקשור ל- ECH (Keap1) כמו Kelch [1], חלבון מתאם מצע ל- Cullin 3 (Cul3) / Rbx1 ubaseitin ligase [2], [3], [ 4]. Keap1 משתמש במנגנון מחזורי יעיל ביותר כדי לכוון את Nrf2 לצורך ייצוג בכל מקום והשפלה פרוטאזומלית, במהלכו מתחדש Keap1 באופן רציף, ומאפשר להמשיך את המחזור (איור 1 א) [5]. Nrf2 גם נתון להשפעה המתווכת על ידי גליקוגן סינטאז קינאז (GSK) 3 /? - תלוי TrCP מבוסס Cul1 ליגזה של אוביקוויטין [6], [7]. לאחרונה דווח כי במהלך מצבים של מתח רטיקולום אנדופלזמי, Nrf2 נמצא בכל מקום ומושפל בתהליך המתווך על ידי ליגאז E3 של יוביקוויטין Hrd1 [8].

איור 1 המחזור רציף מחזורית מודל התחדשות של השפלה Keap1 בתיווך של Nrf2. (א) Nrf2 נקשר ברצף כדי דיפר Keap1 חינם: הראשון דרך זיקה גבוהה שלו ETGE (אדום מקלות) תחום מחייב ולאחר מכן באמצעות זיקה נמוכה שלה DLG (מקלות שחורים) תחום מחייב. ב קונפורמציה זו של מורכבות חלבון, Nrf2 עוברת ubiquitination והוא ממוקד השפלה proteasomal. חינם Keap1 מתחדש ויכול להיקשר לתרגום חדש של Nrf2, והמחזור מתחיל מחדש. (B) Inducers (יהלומים לבנים) מגיבים עם ציסטאין חיישן של Keap1 (מקלות כחולים), מה שמוביל לשינוי קונפורמטיבי ופגיעה במתאם. חינם Keap1 אינו מחדש, ואת nrf2 מסונתז החדש מצטבר ו translocates לגרעין.

בנוסף לשמש תחליף חלבון ליגאז lbase ubiquitin, Keap1 הוא גם חיישן עבור מגוון רחב של activators קטן מולקולה של Nrf2 (המכונה inducers) [9]. Inducers לחסום את המעגל של השפלה Keap1 בתיווך של Nrf2 על ידי שינוי כימי שאריות ציסטאין ספציפיים בתוך Keap1 [10], [11] או על ידי הפרעה ישירה את ממשק Keap1: Nrf2 [12], [13]. כתוצאה מכך, Nrf2 אינו מושפל, גורם התעתיק מצטבר ומתרגם לגרעין (איור 1B), שם הוא יוצר הטרודימר עם חלבון מאפ קטן; נקשר אלמנטים נוגדי חמצון בתגובה, האזורים הרגולטוריים במעלה של גנים היעד שלה; ויזם תמלול [14], [15], [16]. הסוללה של מטרות Nrf2 כוללת חלבונים עם פונקציות cytoprotective מגוונות, כולל אנזימים של מטבוליזם xenobiotic, חלבונים עם פונקציות נוגדות חמצון ו אנטי דלקתיות, וכן יחידות proteasomal, כמו גם חלבונים המווסתים הומאוסטזיס התאוששות הסלולר להשתתף בחילוף החומרים מתווך.

Nrf2: הרגולטור הראשי של התאוששות הומאוסטזיס נייד

הפונקציה של Nrf2 כמווסת ראשי של הומאוסטזיס חיזור סלולרי זוכה להכרה רחבה. הביטוי הגנטי של יחידת המשנה הקטליטית וגם הרגולטורית של? -גלוטמיל ציסטאין ליגאז, האנזים המזרז את השלב המגביל את הקצב בביוסינתזה של גלוטתיון מופחת (GSH), מווסת ישירות על ידי Nrf2 [17]. יחידת המשנה xCT של מערכת xc-, המייבאת ציסטין לתאים, היא גם יעד תעתיק ישיר של Nrf2 [18]. בתא, ציסטין עובר הסבה לציסטאין, מבשר לביוסינתזה של GSH. בנוסף לתפקידו בביוסינתזה של GSH, Nrf2 מספק את האמצעים לשמירה על גלוטתיון במצבו המופחת על ידי ויסות תעתיק מתואם של גלוטתיון רדוקטאז 1 [19], [20], המפחית את הגלוטתיון המחומצן ל- GSH תוך שימוש במקביל הפחתה מ- NADPH. . ה- NADPH הדרוש מסופק על ידי ארבעה אנזימים עיקריים המייצרים NADPH, אנזים מאלי 1 (ME1), איזוציטראט דהידרוגנאז 1 (IDH1), גלוקוז -6 פוספט דהידרוגנאז (G6PD) ו- 6-phosphogluconate dehydrogenase (PGD). מוסדר תעתיק בחלקו על ידי Nrf2 (איור 2) [21], [22], [23], [24]. באופן מוזר, Nrf2 מווסת גם את ביטוי הגנים המושרה של הצורות הציטוזוליות, המיקרוזומליות והמיטוכונדריאליות של אלדהיד דה-הידרוגנאז [25], המשתמשות ב- NAD (P) + כמקדם-גורם, מה שמוליד NAD (P) H. ואכן, רמות ה- NADPH והיחס NADPH / NADP + נמוכות יותר בפיברובלסטים עובריים המבודדים מעכברי Nrf2-knockout (Nrf2-KO) בהשוואה לתאים ממקביליהם מסוג wild-type (WT), ורמות ה- NADPH יורדות עם מציאת Nrf2 ב שורות תאים סרטניים עם Nrf2 פעיל באופן מכונן [26]. כצפוי, רמות ה- GSH נמוכות יותר בתאים שבהם Nrf2 הופרע; לעומת זאת, הפעלת Nrf2 באמצעים גנטיים או פרמקולוגיים מובילה לוויסות GSH [27], [28], [29]. חשוב לציין, Nrf2 מווסת גם את הביטוי הגנטי של תיורודוקסין [30], [31], [32], תיוארדוקסין רדוקטאז 1 [28], [29], [32], [33] וסולפירדוקסין [34], שהם חיוניים. להפחתת תיולים חלבונים מחומצנים.

איור 2 תפקידו של Nrf2 בחילוף החומרים של תאים מתרבים במהירות. Nrf2 הוא מווסת חיובי של גנים המקודדים אנזימים הן בזרוע החמצונית [כלומר גלוקוז -6-פוספט דהידרוגנאז (G6PD) והן ב- 6-phosphogluconate dehydrogenase (PGD)] ובזרוע הלא-חמצונית [כלומר, טרנסאלדולאז 1 (TALDO1) וטרנסקטולאז ( TKT)] של מסלול הפוספט הפנטוז. G6PD ו- PGD מייצרים NADPH. Nrf2 מווסת גם את ביטוי הגנים של שני האנזימים הנוצרים NADPH אחרים, אנזים מאלי 1 (ME1) ואיזוציטרט דהידרוגנאז 1 (IDH1). הביטוי הגנטי של פוספוריבוזיל פירופוספט אמידוטרנספרז (PPAT), המזרז את הכניסה למסלול הביוסינתטי הפורני דה נובו, מווסת גם כן על ידי Nrf2, וכך גם הביטוי של מתילנטטרהידרופולאט דהידרוגנאז 2 (MTHFD2), אנזים מיטוכונדריאלי בעל תפקיד קריטי ב מתן יחידות חד פחמתיות לביוסינתזה של פורו דה נובו. קינאז פירובט (PK) מווסת באופן שלילי על ידי Nrf2 וצפוי להעדיף הצטברות של חומרים בינוניים גליקוליטיים, יחד עם G6PD, ניתוב מטבוליטים במסלול פוספט פנטוז וסינתזה של חומצות גרעין, חומצות אמינו ופוספוליפידים. Nrf2 מווסת שלילית את הביטוי הגנטי של ATP- ציטראט ליאז (CL), מה שעשוי להגדיל את הזמינות של ציטראט לשימוש במיטוכונדריה או (באמצעות איזוציטראט) ל- IDH1. אדום וכחול מצביעים על ויסות חיובי ושלילי, בהתאמה. המיטוכונדריה מוצגת באפור. קיצורי מטבוליט: G-6-P, גלוקוז 6-פוספט; F-6-P, פרוקטוז 6-פוספט; F-1,6-BP, פרוקטוז 1,6-ביספוספט; GA-3-P, גליצראלדהיד 3-פוספט; 3-PG, 3-phosphoglycerate; PEP, phosphoenolpyruvate; 6-P-Gl, 6-phosphogluconolactone; 6-PG, 6-פוספוגלוקונאט; R-5-P, ריבולוז 5-פוספט; PRPP, 5-פוספוריבוזיל -? - 1-פירופוספט; THF, טטרהידרופולאט; IMP, מונוספט פוספט; AMP, אדנוזין מונופוספט; GMP, מונופוספט גואנוזין.

בהתחשב בתפקיד המכריע של Nrf2 כווסת ראשי של הומאוסטזיס לחיסכון תאים סלולריים, אין זה מפתיע כי, בהשוואה לתאי WT, רמות מינים של חמצן תגובתי (ROS) גבוהות יותר בתאים בהם Nrf2 הופר (Nrf2-KO) [35]. הבדל זה בולט במיוחד על האתגר עם סוכנים הגורמים ללחץ חמצוני. יתר על כן, תאים לקויים Nrf2 הם הרבה יותר רגישים לרעילות של חמצון מסוגים שונים ולא ניתן להגן על ידי Nrf2 inducers, אשר, באותם תנאים, לספק הגנה יעילה לאורך זמן לתאי WT [29], [36] , [37]. בנוסף ההומאוסטזיס החמצני הכולל הסלולר, Nrf2 הוא קריטי גם עבור תחזוקה של הומאוסטזיס החזר המיטוכונדריה. לכן, לעומת WT, הבריכה NADH המיטוכונדריאלי הכולל גדל באופן משמעותי Keap1-KO ו ירד באופן דרמטי בתאי Nrf2-KO [35].

באמצעות הדמיה תאית חיה, אנחנו לאחרונה פיקוח על שיעורי ייצור ROS ב cocultures glioneuronal ראשוני פרוסות רקמת המוח מבודדים מ WT, Nrf2-KO, או Kep1-downdown (Keap1-KD) עכברים [38]. כצפוי, קצב הייצור ROS היה מהיר יותר בתאי Nrf2-KO ורקמות לעומת עמיתיהם WT שלהם. עם זאת, ערכנו את תצפית בלתי צפויה כי, לעומת WT, תאים Keap1-KD יש גם שיעורי גבוה יותר של ייצור ROS, אם כי גודל ההבדל בין WT לבין גנוטיפים Keap1-KD היה קטן יותר מאשר בין WT ו Nrf2-KO . לאחר מכן ניתחנו את רמות ה- mRNA של NOX2 ו- NOX4, יחידות המשנה הקטליטיות של שני האיזופורדים של NADPH oxidase (NOX) אשר היו מעורבים בפאתולוגיה של המוח, ומצאו כי NOX2 גדל באופן דרמטי בתנאים של מחסור ב- Nrf2, בעוד ש- NOX4 נמצא במצב של uprulated כאשר Nrf2 הוא מופעל באופן מהותי, אם כי במידה קטנה יותר. כמותית, את גודל upregulation בתאים ורקמות של עכברים מוטציה מקבילים העליות המקביל בייצור ROS [38]. מעניין, לא רק Nrf2 לווסת חמצן NADPH, אבל ROS המיוצר על ידי NADPH oxidase יכול להפעיל Nrf2, כפי שמוצג בתאי אפיתל ריאתי cardiomyocytes [39], [40]. יתר על כן, מחקר עדכני מאוד הוכיח כי ההפעלה NADPH תלויי oxidase של Nrf2 מהווה מנגנון אנדוגני חשוב להגנה מפני נזק המיטוכונדריה ומוות התאים בלב במהלך עומס יתר לחץ [41].

בנוסף לפעילות קטליטי של NADPH אוקסידאז, הנשימה המיטוכונדריאלי הוא מקור תאיים מרכזי נוסף של ROS.By באמצעות בדיקה המיטוכונדריה ספציפית MitoSOX, בדקנו את התרומה של ROS של המיטוכונדריה המוצא לייצור ROS הכולל ב cocultures glioneural העיקרי מבודדים מ WT, Nrf2-KO, או Kep1-KD עכברים [38]. כצפוי, Nrf2-KO תאים היו שיעורי גבוה יותר של ייצור המיטוכונדריה ROS מאשר WT. בהתאם לממצאים של הייצור ROS הכולל, שיעורי הייצור המיטוכונדריה ROS ב Keap1-KD היו גם גבוהים יותר לעומת תאים WT. חשוב לציין, חסימה מורכבת אני עם rotenone גרמה לעלייה דרמטית בייצור ROS המיטוכונדריה בשני תאים WT ו Keap1-KD, אבל לא היתה השפעה על תאים Nrf2-KO. בניגוד לעלייה הצפויה בייצור המיטוכונדריה ROS בתאי WT לאחר תוספת של pyruvate (כדי לשפר את הזמינות של NADH, להגדיל את פוטנציאל הממברנה המיטוכונדריה, לנרמל את הנשימה), הייצור של ROS ירד בתאי Nrf2-KO. יחד עם זאת, ממצאים אלה מצביעים על כך, בהיעדר Nrf2:) i (הפעילות של המורכב I נפגעת,) ii (הפעילות הלקויה של המורכב I נובעת מגבלת מצעים,) iii (הפעילות הפגומה של מורכבות אני אחת הסיבות העיקריות לייצור מיטוכונדריה ROS מוגברת, אולי בגלל זרימת אלקטרונים הפוכה מ II המורכב.

Nrf2 משפיע על פוטנציאל קרום מיטוכונדריאלי ונשימה

פוטנציאל הממברנה המיטוכונדריה (?? מ ') הוא אינדיקטור אוניברסלי לבריאות המיטוכונדריה ומצב חילוף החומרים של התא. בתא בריא, נשמרת על ידי שרשרת הנשימה המיטוכונדריה. מעניין לציין כי תיוג איזוטופי יציב עם חומצות אמינו במחקר פרוטאומיקה מבוסס תרבות במבחן האף-אפיתל של השד האנושי, הלא שלילי של קולטן אסטרוגן, הראה כי רכיב שרשרת הובלת האלקטרונים המיטוכונדריה NDUFA10 מוגדר על ידי הפעלה פרמקולוגית (על ידי סולפוראפאן) של Nrf4, ואילו ויסות גנטי של Nrf2 (על ידי מציאת Keap2) מוביל לוויסות למטה של ​​יחידות המשנה הציטוכרום c אוקסידאז COX1 ו- COX2I4 [1]. מחקר שנערך על פרוטאום הכבד באמצעות אלקטרופורזה ג'ל דו מימדית וספקטרומטריית מסה לייזר / ספיגת לייזר בעזרת מטריצה, מצא כי Nrf42 מווסת את הביטוי של יחידת משנה ATP סינתזה? [2]. בנוסף, דווח כי החלבון המיטוכונדריאלי DJ-43, הממלא תפקיד בשמירה על פעילות מתחם I [1], מייצב את Nrf44 [2], [45], אם כי ההשפעות הנוירו-מגן של הפעלה פרמקולוגית או גנטית. של Nrf46 אינם תלויים ב- DJ-2 [1]. עם זאת, ההשלכות של תצפיות אלה על תפקוד המיטוכונדריה לא נחקרו.

בהסכמה לפעילות לקויה של מתחם I בתנאים של מחסור Nrf2, הבסיס הבסיסי נמוך יותר ב- Fibroblasts עובריים מסוג Nrf2-KO (MEFs) ובתאים גלוריונורליים ראשוניים מתורבתים בהשוואה לעמיתיהם ב- WT (איור 3, שיבוץ). [35]. לעומת זאת, הבסיס הבסיסי גבוה יותר כאשר ה- Nrf2 מבוקר באופן גנטי מבחינה גנטית (על ידי מציאה או נוקאאוט של Keap1). הבדלים אלו ב- m בין הגנוטיפים מצביעים על כך שהנשימה מושפעת מפעילות ה- Nrf2. ואכן, הערכה של צריכת החמצן במצב הבסיס העלתה כי בהשוואה ל- WT, צריכת החמצן נמוכה יותר ב- Nrf2-KO ו- Keap1-KO MEFs, ב- ~ 50 ו- ~ 35% בהתאמה.

איור 3 הציע מנגנון פונקציה המיטוכונדריה נפגעת בתנאים של מחסור Nrf2. (1) הירידות ברמות ME1, IDH1, G6PD ו- PGD מביאות לרמות NADPH נמוכות יותר. (2) גם רמות ה- GSH נמוכות. (3) הפעילות הנמוכה של ME1 עשויה להפחית את מאגר הפירובט הנכנס למיטוכונדריה. (4) הדור של NADH איטי יותר, מה שמוביל לפגיעה בפעילות של מורכבות I ולהגברת ייצור ה- ROS המיטוכונדריאלי. (5) ההפחתה של FAD ל- FADH2 בחלבונים המיטוכונדריה פחתה גם היא, והורידה את זרימת האלקטרונים מ- FADH2 ל- UbQ ולמתחם III. (6) היווצרות איטית יותר של UbQH2 עשויה להוריד את פעילות האנזים של סוצינאט דה-הידרוגנאז. (7) הרמות המוגברות של ROS עשויות לעכב עוד יותר את הפעילות של קומפלקס II. (8) היעילות הנמוכה יותר של חמצון חומצות שומן תורמת לירידה בזמינות המצע לנשימה מיטוכונדריאלית. (9) הגליקוליזה משופרת כמנגנון מפצה לירידה בייצור ה- ATP בזרחון חמצוני. (10) סינתזת ה- ATP פועלת לאחור כדי לשמור על מ '. אדום וכחול מצביעים על פיקוח מעלה ורגולציה, בהתאמה. התיבות מסמלות זמינות של עדויות ניסיוניות. הכניסה מציגה תמונות של מיטוכונדריה של WT ו- Nrf2-KO אסטרוציטים בקליפת המוח המדמיינים על ידי הבדיקה הפלואורסצנטית הפוטנציומטרית tetramethylrhodamine אסתר מתיל (TMRM; 25 ננומטר). סרגל קנה מידה, 20 מטר.

הבדלים אלה ב- m ובנשימה בקרב הגנוטיפים באים לידי ביטוי בקצב הניצול של מצעים לנשימה מיטוכונדריאלית. יישום מצעים למחזור החומצה הטריקרבוקסילית (TCA) (מלט / פירובט, שמגדיל בתורו את ייצור המצע המורכב I NADH) או מתיל סוצינאט, מצע למתחם II, גורם לעלייה שלשלושה מ 'בשני WT. ונוירונים Keap1-KD, אך קצב העלייה גבוה יותר בתאי Keap1-KD. חשוב מכך, צורות התגובה למצעי מחזור TCA אלה שונות בין שני הגנוטיפים, לפיה העלייה המהירה ב- ² מ 'בתאי Keap1-KD עם הוספת המצע באה בעקבות ירידה מהירה ולא מישור, דבר המצביע על כך שאינו יוצא דופן. צריכת מצע מהירה. ממצאים אלה עומדים בקנה אחד עם רמות נמוכות בהרבה (של 50%) של מלאט, פירובט וסוקסינט שנצפו לאחר דופק של שעה של גלוקוז [U-70C1] ב- Keap13-KO בהשוואה ל- WT MEF. תאים [6]. בנוירונים Nrf1-KO, רק פירובט מסוגל להגדיל את ה- m, ואילו מלט ומתיל סוצינאט גורמים לדפולריזציה קלה. נראה שההשפעה של Nrf24 על ייצור המצעים המיטוכונדריה היא המנגנון העיקרי לפיו Nrf2 משפיע על תפקוד המיטוכונדריה. אינדקס החיזור המיטוכונדריאלי של NADH (האיזון בין צריכת NADH על ידי מורכבות I לבין ייצור NADPH במחזור TCA) נמוך משמעותית בתאי Nrf2-KO בהשוואה לעמיתיהם ב- WT, ויתרה מכך, שיעורי ההתחדשות של בריכות NADH ו- FADH2 לאחר עיכוב של IV מורכב (באמצעות NaCN) הם איטיים יותר בתאי המוטציה.

במיטוכונדריה המבודדת ממוח עכבר וכבד, תוספת של מצעים למתחם I או למורכב II מגבירה את קצב צריכת החמצן ביתר חזק כאשר מופעל Nrf2 ופחות יעיל כאשר Nrf2 מופרע [35]. לפיכך, מלאט גורם לשיעור גבוה יותר של צריכת חמצן ב- Keap1-KD בהשוואה ל- WT, אך השפעתו חלשה יותר במיטוכונדריה Nrf2-KO. באופן דומה, בנוכחות רוטנון (כאשר מעוכב מורכב I), succinate מפעיל את צריכת החמצן במידה רבה יותר ב- Keap1-KD בהשוואה ל- WT, ואילו התגובה במיטוכונדריה Nrf2-KO פוחתת. בנוסף, תרבויות ועצבי עצב ראשוניים Nrf2-KO רגישים יותר לרעילות של מעכבי מורכבים II-3-חומצה ניטרופופיונית ומלונה, ואילו השתלת תוך-אמצעי של אסטרוציטים המבטאים יתר על המידה Nrf2 מגנה [48], [49]. באופן דומה, עכברי Nrf2-KO רגישים יותר, ואילו להפעלה גנטית או פרמקולוגית של Nrf2 יש השפעות מגנות מפני רעילות עצבית הנגרמת על ידי מעכב I המורכב I-methyl-1-phenylpyridinium ב 4-methyl-1-phenyl-4, מודל בעלי חיים 1,2,3,6-טטרהידרופירידין ממחלת פרקינסון [49], [50], [51], [52], [53], [54], [55], [56], [57], [58], [59], [60], [61].

יחס בקרת הנשימה (RCR), היחס בין מצב 3 (מגורה ב- ADP) לנשימה של מצב 4 (ללא ADP), פחת בהעדר Nrf2, אך ה- RCR דומה בין המיטוכונדריה של Keap1-KD ו- WT [35 ]. מכיוון שה- RCR הוא אינדיקציה למידת הצמדה של פעילות שרשרת הנשימה המיטוכונדריאלית לזרחן חמצוני, ממצא זה מצביע על כך שקצב הנשימה הגבוה יותר במיטוכונדריה Keap1-KD אינו נובע מניתוק של זרחון חמצוני. עוד עולה כי זרחון חמצוני יעיל יותר כאשר מופעל Nrf2. קצב הנשימה הגבוה יותר במיטוכונדריה של Keap1-KD עולה בקנה אחד עם הרמות הגבוהות יותר של ייצור ROS מיטוכונדריאלי [38] מכיוון ששיעורי נשימה גבוהים יותר עשויים להוביל לדליפת אלקטרונים מוגברת. עם זאת, בתנאים של לחץ חמצוני, ייצור ה- ROS המוגבר מנוגד על ידי ויסות תעתיק תלוי Nrf2 של חלבון 3 ללא צימוד (UCP3), מה שמגביר את מוליכות הפרוטון של הקרום הפנימי המיטוכונדריאלי וכתוצאה מכך מקטין את ייצור הסופר-חמצני [62]. ממש לאחרונה הוצג כי תוצר החמצון השומני 4-hydroxy-2-nonenal מתווך את הסדרת ה- NRF2 תלויה ב- UCP3 בקרדיומיוציטים; זה עשוי להיות חשוב במיוחד להגנה בתנאים של לחץ חמצוני כמו אלה במהלך איסכמיה.עירוי מחדש [63].

Nrf2 משפיע על היעילות של זרחון חמצוני סינתזה של ATP

בהסכמה להשפעה של Nrf2 על הנשימה, במיטוכונדריה במוח ובכבד, מחסור ב- Nrf2 מביא לירידה ביעילות של זרחון חמצוני (כפי שמוערך על ידי היחס בין ADP לחמצן הנצרך לצורך סינתזת ATP), ואילו הפעלת Nrf2 (Keap1 ל- KD) יש השפעה הפוכה [35]. בהשוואה ל- WT, רמות ה- ATP גבוהות משמעותית בתאים עם ויסות מכונן של Nrf2 ונמוכות יותר כאשר Nrf2 מושפל [64] או משבש [35]. יתר על כן, השימוש במעכבים של זרחון חמצוני (אוליגומיצין) או גליקוליזה (חומצה יודואצטית) גילה כי Nrf2 משנה את הדרך בה תאים מייצרים ATP. לפיכך, בתאי עצב של ה- WT, אוליגומיצין גורם לירידה מוחלטת ב- ATP ולחומצה האיודואצטית אין השפעה נוספת. למרבה הפלא, בתאי Nrf2-KO, אוליגומיצין מעלה את רמות ה- ATP, שאז מתמעטות על ידי חומצה יודואצטית באטיות, אך לחלוטין, מה שמעיד כי בהיעדר Nrf2, הגליקוליזה, ולא הזרחון החמצוני, הוא המקור העיקרי לייצור ATP. מעניין שלמרות היעילות המוגברת של זרחון חמצוני בתאי Keap1-KD, תוספת של אוליגומיצין מביאה לירידה של ~ 80% ברמות ה- ATP, וחומצה iodoacetic גורמת לירידה נוספת של ~ 20%. לפיכך, מחסור ב- Nrf2 או הפעלתו המכוננת מפחיתים את התרומה של זרחון חמצוני ומגדילים את תרומת הגליקוליזה לסינתזה של ATP. השפעה זו בולטת במיוחד כאשר Nrf2 נעדר ועולה בקנה אחד עם התלות של ה- m על נוכחות הגלוקוז במדיום [35] והרמות המוגברות של חומרי הביניים הגליקוליטיים (G-6-P, F-6-P , dihydroxyacetone phosphate, pyruvate, and lactate) לאחר מציאה של Nrf2 [24].

העלייה ברמות ה- ATP לאחר עיכוב ה- F1F0-ATPase על ידי אוליגומיצין מצביעה על כך שבהעדר Nrf2, ה- F1F0-ATPase מתפקד כ- ATPase ולא כ- ATP synthase, כלומר הוא פועל לאחור. היפוך כזה בפעילות משקף ככל הנראה את הצורך לשאוב פרוטונים על פני הקרום המיטוכונדריאלי הפנימי בניסיון לשמור על ה- m מ ', שהוא קריטי לשלמות התפקודית של אברון זה. ההיפוך של תפקוד ה- F1F0-ATPase מעיד גם על ידי הדפולריזציה המיטוכונדריאלית שנצפתה במתן אוליגומיצין לתאי Nrf2-KO, אשר עומד בניגוד חד להיפרפולריזציה המתרחשת במקביליהם ל- WT או ל- Keap1 [35]. בסך הכל, נראה כי בתנאים של מחסור Nrf2 ATP מיוצר בעיקר בגליקוליזה, ו- ATP זה משמש בחלקו על ידי F1F0-ATPase לשמירה על ה- m.

Nrf2 משפר חמצון חומצות מיטוכונדריאלי

ההשפעה של מחסור ב- Nrf2 על ה- mm בולטת במיוחד כאשר תאים מודגרות במדיום ללא גלוקוז, ו- mm נמוך ב- 50% ב- Nrf2-KO בהשוואה לתאי WT [35]. בתנאים של מחסור בגלוקוז, חמצון חומצות שומן מיטוכונדריאליות (FAO) הוא הספק העיקרי של מצעים לנשימה ולזרחן חמצוני, מה שמרמז כי Nrf2 עשוי להשפיע על ה- FAO. ואכן, היעילות של FAO הן עבור חומצת השומן הרוויה עם חומצות שומן רוויות ארוכות (C16: 0) והן עבור חומצה הקסנואית קצרת השרשרת (C6: 0) גבוהה יותר ב- MEFs של Keap1-KO ובמיטוכונדריה של לב וכבד מבודדת מאשר אצל עמיתיהם ל- WT, בעוד שהוא נמוך יותר בתאי Nrf2-KO ומיטוכונדריה [65]. השפעות אלו רלוונטיות מאוד גם לבני אדם: אכן, שינויים מטבוליים המעידים על שילוב טוב יותר של ה- FAO עם פעילות מחזור ה- TCA דווחו כי התרחשו במחקרי התערבות אנושית בתזונה עשירה בגלוקוראפנין, מבשרו של מפעיל ה- Nrf2 הקלאסי סולפוראפאן [ 66].

במהלך השלב הראשון של ה- FAO המיטוכונדריאלי, המימן ה- pro-R של ה-? פחמן עוזב כהידריד המפחית את גורם ה- FAD ל- FADH2, אשר בתורו מעביר אלקטרונים לאוביקווינון (UbQ) בשרשרת הנשימה, ובסופו של דבר תורם לייצור ATP. . בעוד שגירוי ה- FAO על ידי פלמיטוילקארניטין בהיעדר גלוקוז גורם לעלייה הצפויה ברמות ה- ATP בתאי WT ו- Keap1-KO, כאשר עליית ה- ATP מהירה יותר בתאי Keap1-KO, הטיפול הזהה אינו מייצר שינויים ב- ATP ב- Nrf2-KO. MEFs [65]. ניסוי זה מדגים כי בהיעדר Nrf2, ה- FAO מדוכא, ויתרה מכך, הוא מביא לדיכוי ה- FAO כאחת הסיבות לרמות ה- ATP הנמוכות יותר בתנאים של מחסור ב- Nrf2 [35], [64].

יש לציין כי תאים אנושיים של 293 T, בהם Nrf2 הושתקו יש ביטוי נמוך יותר של CPT1 ו- CPT2 [67], שני איזופורמים של palmitoyltransferase קרניטין (CPT), האנזים המגביל את קצב המיטוכונדריה. בהסכם, רמות ה- mRNA של Cpt1 נמוכות יותר בכבדים של Nrf2-KO בהשוואה לעכברי WT [68]. CPT מזרז את העברת קבוצת Acyl של שרשרת ארוכה של שמן acyl-COA מקואנזים A ל-קרניטין ובכך מאפשר יבוא של acylcarnitine מן הציטופלסמה לתוך המיטוכונדריה. אמנם זה לא נבדק עד כה, ייתכן כי בנוסף להשפעות תעתיק על ביטוי CPT1, Nrf2 עשוי להשפיע גם על תפקוד האנזים הזה על ידי שליטה על רמות המעכב האלוסטרי העיקרי שלה, malonyl-CoA. הסיבה לכך היא, על ידי מנגנון זה אינו ברור כרגע, Nrf2 מסדיר שלילית את הביטוי של stearoyl CoA desaturase (SCD) [69] ו litase ציטראט (CL) [69], [70]. למרבה הפלא, נוקאאוט או עיכוב של SCD מוביל להגדלת זירזון והפעלה של AMP-activated חלבון קינאז (AMPK) [71], [72], [73], וזה יכול להיות השערות כי, בהעדר Nrf2, את רמות SCD יגדיל, בתורו הפחתת פעילות AMPK. זה יכול להיות מורכב עוד יותר על ידי רמות חלבון מופחת של AMPK כי נצפו בכבד של עכברים Nrf2-KO [68], ממצא זה תואם את רמות AMPK מוגברת, אשר דווחו כבדים של Keap1-KD עכברים [74]. אחת התוצאות של ירידה בפעילות AMPK היא הקלה של הזרחון המעכב שלה (ב- Ser79) של ACXL-COA carboxylase (ACC) [75], אשר יכול להיות upcriptulated transcriptionally בהיעדר Nrf2 כי הוא downregulated על ידי הפעלה Nrf2 [70 ]. פעילות ACC גבוהה, בשילוב עם ביטוי CL upregulated כי יגדיל את הייצור של אצטיל- CoA, המצע עבור ACC, עלול בסופו של דבר להגדיל את רמות המוצר ACC, malonyl-CoA. רמות גבוהות של malonyl-CoA יהיה לעכב CPT, ובכך להקטין את התחבורה של חומצות שומן לתוך המיטוכונדריה. לבסוף, Nrf2 חיובי מסדיר את הביטוי של CD36 [76], translocase שמייבא חומצות שומן על פני קרום פלזמה ומיטוכונדריה. לכן, מנגנון אחד שבו Nrf2 עשוי להשפיע על היעילות של המיטוכונדריה FAO הוא על ידי ויסות יבוא של שרשרת חומצות שרשרת ארוכות לתוך המיטוכונדריה.

בנוסף תקנה תעתיק ישיר, Nrf2 עשוי גם לשנות את היעילות של המיטוכונדריה FAO על ידי השפעותיו על חילוף החומרים התאוששות הסלולר. זה עשוי להיות רלוונטי במיוחד כאשר Nrf2 פעילות נמוכה או נעדר, תנאים אשר משנים את מצב החמצן הסלולר לכיוון המדינה חמצון. ואכן, מספר אנזימים של ה- FAO זוהו כבעלי רגישות לשינויים בתהליכי החמצון. אנזים אחד כזה הוא ארוך מאוד שרשרת acyl-COA dehydrogenase (VLCAD), אשר תורמת יותר מ 80% לפעילות palhyoyl-CoA dehydrogenation ברקמות האדם [77]. מעניין, Hurd et al. [78] הראו כי VLCAD מכיל שאריות ציסטאין כי לשנות באופן משמעותי את מצב החמצון שלהם על החשיפה של לב בודד חולדה המיטוכונדריה כדי H2O2. בנוסף, S-nitrosylation של VLCAD בכבד Murine ב Cys238 משפר את היעילות הקטליטית של האנזים [79], וסביר כי חמצון של ציסטאין אותו עשויה להיות השפעה הפוכה, בסופו של דבר להקטין את היעילות של המיטוכונדריה FAO. לכן, למרות שרמות הביטוי של VLCAD אינן שונות באופן משמעותי ב- WT, Nrf2-KO או Keap1-KO MEF [65], פעילות האנזים של VLCAD יכולה להיות נמוכה יותר בהעדר Nrf2 בשל רמות גבוהות יותר של ROS.

בהתבסס על כל הממצאים הללו, ניתן להציע כי (איור 3): בהעדר Nrf2, רמות ה- NADPH נמוכות יותר בגלל ירידה בביטוי של ME1, IDH1, G6PD ו- PGD. רמות הגלוטתיון המופחתות נמוכות יותר גם עקב ירידה בביטוי של אנזימים המשתתפים בביוסינתזה וההתחדשות שלו והרמות הנמוכות יותר של NADPH הנדרשות להמרת המחומצן לצורה המופחתת של גלוטתיון. הביטוי הנמוך של ME1 יקטין את מאגר הפירובט הנכנס למיטוכונדריה, כאשר הגליקוליזה יהפוך למקור העיקרי לפירובט. הדור של NADH איטי יותר, מה שמוביל לפגיעה בפעילות של מורכבות I ולהגברת ייצור ה- ROS המיטוכונדריאלי. ההפחתה של FAD ל- FADH2 גם איטית יותר, לפחות בחלקה בגלל חמצון יעיל פחות של חומצות שומן, המסכן את זרימת האלקטרונים מ- FADH2 ל- UbQ ולמתחם III. מכיוון ש- UbQH2 הוא מפעיל של סוקצינט דה-הידרוגנאז [80], האטת היווצרותו עשויה להוריד את פעילות האנזים של סוצינאט דה-הידרוגנאז. הרמות המוגברות של סופר-חמצני ומי חמצן יכולות לעכב את פעילות מורכבת II עוד יותר [81]. היעילות הנמוכה יותר של חמצון חומצות שומן תורמת לירידה בזמינות המצע לנשימה מיטוכונדריאלית וייצור ATP בזרחון חמצוני. כמנגנון מפצה, הגליקוליזה משופרת. ATP synthase מתפקד לאחור, כ- ATPase, בניסיון לשמור על ה-

Nrf2 וביוגנזה מיטוכונדריה

דווח כי בהשוואה ל- WT, לכבדי עכברי Nrf2-KO יש תוכן מיטוכונדריאלי נמוך יותר (כפי שנקבע על ידי היחס בין המיטוכונדריה ל- DNA גרעיני); זה פחת עוד יותר בצום של 24 שעות הן בעכברי WT והן ב- Nrf2-KO; לעומת זאת, אם כי לא שונה מ- WT בתנאי האכלה רגילים, התוכן המיטוכונדריאלי בעכברים עם פעילות Nrf2 גבוהה אינו מושפע מצום [82]. מעניין לציין כי תוספת עם הפעלת Nrf2 (R) -? - חומצה ליפואית [83], [84], [85] מקדמת ביוגנזה מיטוכונדריאלית באדיפוציטים 3T3-L1 [86]. שני סוגים של רגולטורי תעתיק גרעיניים ממלאים תפקידים קריטיים בביוגנזה המיטוכונדריאלית. המחלקה הראשונה הינה גורמי תעתיק, כגון גורמי נשימה גרעיניים 11 ו- 2, השולטים בביטוי של גנים המקודדים יחידות משנה של חמשת קומפלקסי הנשימה, רכיבי טרנסלציה של המיטוכונדריה, ואנזימים ביוסינתטיים של המם הממוקמים למטריצה ​​המיטוכונדריאלית [88]. Piantadosi et al. [89] הראו כי ויסות התעתיק תלוי ה- Nrf2 של גורם נשימה גרעיני 1 מקדם ביוגנזה של המיטוכונדריה ומגן מפני רעילות ציטוטית של הסוכן הכימותרפי האנתרציקלין הקרדיוטוקסי דוקסורוביצין. לעומת זאת, ג'אנג ואח '. [82] דיווחו כי הפעלה גנטית של Nrf2 אינה משפיעה על ביטוי ה- mRNA הבסיסי של גורם נשימה גרעיני 1 בכבד העכברי.

המעמד השני של מווסתים תעתיקיים גרעיניים עם פונקציות קריטיות בביוגנזה המיטוכונדריאלית הם קואקטואיטיבי תעתיק, כמו קולטן המופעל על ידי התפשטות פרוקסיזום? coactivators (PGC) 1? ו- 1 ?, המתקשרים עם גורמי שעתוק, מכונות התעתיק הבסיסי וחיתוך ה- RNA, ואנזימים המשתנים היסטון [88], [90], [91]. הביטוי של משפחת הקואקטיביבים PGC1 מושפע ממספר רב של אותות סביבתיים. טיפול בפיברובלסטים אנושיים באמצעות הפעלת ה- Nrf2 sulforaphane גורם לעלייה במסת המיטוכונדריה ולהשראה של PGC1? ו- PGC1? [92], אם כי התלות הפוטנציאלית ב- Nrf2 לא נבדקה במחקר זה. עם זאת, עכברים סוכרתיים בהם Nrf2 מופעל על ידי מציאה של גן Keap1 היפומורפי (db / db: Keap1flox / ?: Nrf2 + / +) או שהופרעו (db / db: Keap1flox / ?: Nrf2? /?) יש PGC1 בכבד נמוך יותר? רמות ביטוי מאשר חיות שליטה (db / db: Keap1flox / +: Nrf2 + / +) [93]. אין הבדלים ברמות ה- mRNA עבור PGC1? נראים בכבדים של עכברים לא סוכרתיים שהם WT או Nrf2-KO, ואילו רמות אלה נמוכות יותר בבעלי חיים Nrf2- overexpressing (Keap1-KD ו- Keap1-KO ספציפיים לכבד) [82] יש לציין כי צום של 24 שעות מגדיל את רמות ה- PGC1? mRNA בכבדות של עכברים מכל הגנוטיפים, אך העלייה גדולה משמעותית בכבדים של Nrf2-KO בהשוואה לעכברים מסוג WT או Nrf2. בהשוואה ל- WT, עכברי Nrf2-KO שחוו זיהום ספיגה או פציעת ריאות חריפה עקב זיהום מראים כי ויסות תעתיק מוחלש של גורם נשימה גרעיני 1 ו- PGC1? [94], [95]. יחד, תצפיות אלה מצביעות על כך שתפקידו של Nrf2 בשמירה על רמות גורם נשימה גרעיני 1 ו- PGC1? מורכב והופך לבולט ביותר בתנאי לחץ.

בנוסף לביטוי של גנים המקודדים חלבונים מיטוכונדריאליים, ביוגנזה של המיטוכונדריה דורשת סינתזה של נוקלאוטידים. הפעלה גנטית של Nrf2 משפרת את הביוסינתזה של הפורין על ידי ויסות המסלול של פוספט פנטוז ואת חילוף החומרים של חומצה פולית וגלוטמין, במיוחד בתאים המתרבים במהירות (איור 2) [24]. ניתוח התעתיק של דרוזופילה המוטנטית החסרה לסרין המיטוכונדריאלי / חלבון תריאונין קינאז PTEN המושרה על ידי קינאז 1 (PINK1) הראה כי תפקוד לקוי של המיטוכונדריה מוביל לוויסות תעתיק של גנים המשפיעים על חילוף החומרים של נוקלאוטיד [96], דבר המצביע על כך שביוסינתזה של נוקליאוטיד משופרת. מייצג מנגנון להגנה מפני ההשלכות הנוירוטוקסיות של מחסור ב- PINK1. Nrf2 מווסת את הביטוי של phosphoribosyl pyrophosphate amidotransferase (PPAT), שמזרז את הכניסה למסלול הביוסינתטי של נובליאוטיד נובליאוטידי דה נובו, ואת מתילנטרטטרהידרופולאט דה-הידרוגנאז 2 (MTHFD2) מיטוכונדריאלי (איור 2). זה האחרון הוא אנזים דו-פונקציונלי עם פעילויות של דה-הידרוגנאז ו cyclohydrolase, שהוא קריטי במתן גליצין ופורמט כמקור ליחידות חד-פחמתיות לביוסינתזה של פורין בתאים הגדלים במהירות [97]. לכן סביר להניח שהפעלת Nrf2 עשויה להיות מגנה ועלולה להפוך הפרעה בתפקוד המיטוכונדריה במחסור ב- PINK1. ואכן, הפעלה פרמקולוגית של Nrf2 על ידי sulforaphane, או הטריטרפנואיד RTA-408, משחזרת את מ 'ומגנה על תאים חסרי PINK1 מפני רעילות לדופמין [98]. למרות שנראה שהמנגנונים הבסיסיים מורכבים, יחד, ממצאים אלה מצביעים על כך שפעילות Nrf2 עשויה להשפיע על ביוגנזה של המיטוכונדריה על ידי השפעה על רמות הביטוי של גורמי שעתוק קריטיים וקואקטיביבים, כמו גם על ידי שיפור הביוסינתזה של נוקלאוטיד.

Nrf2 ו שלמות מיטוכונדריאלי

למרות ראיות ישירות לא תמיד זמין, יש אינדיקציות חזקות כי Nrf2 חשוב שלמות המיטוכונדריה, במיוחד בתנאים של לחץ חמצוני. מיטוכונדרייה המבודדת מהמוח והכבד של חולדות אשר ניתנו מנה אחת של nulfxNUMX sulforaphane activator הם עמיד בפני פתיחת הנקבוביות חדירות המיטוכונדריה (mPTP) נגרמת על ידי חמצון tert-butylhydroperoxide [2], [99]. ה- mPTP, קומפלקס המאפשר לקרום הפנימי המיטוכונדריאלי להיות חדיר למולקולות עם המונים עד 100 דה, זוהה לאחרונה כדי להיווצר מן dimers של synthase F1500F0-ATP [1]. ההתנגדות sulforaphane בתיווך לפתיחת mPTP בקורלציה עם הגנות נוגדי חמצון מוגברת, ואת רמות המיטוכונדריאלי GSH, גלוטתיון peroxidase 101, אנזים Malic 1, ו thioredoxin 3 הם כולם upregulated שברים המיטוכונדריה מבודדים בעלי חיים מטופלים sulforaphane [2].

נזק לחלבון מיטוכונדריאלי וליקוי בנשימה הנגרם על ידי מוצר החמצון השומני האלקטרופילי 4-hydroxy-2-nonenal מוחלשים במיטוכונדריה מבודדת מקליפת המוח של עכברים שטופלו ב- sulforaphane [102]. בתאי אפיתל כלייתיים בחולדה ובכליות, סולפוראפן מגן מפני רעילות המושרה על ידי ציספלטין וגנטמיצין ואובדן של £ m [103], [104]. כמו כן נצפתה הגנה מפני פאנל של חומרים מחמצנים (סופר-חמצני, מי חמצן, פרוקסיניטריט) ואלקטרופילים (4-hydroxy-2-nonenal ו- acrolein) ועלייה בהגנות נגד נוגדי חמצון במיטוכונדריה עם טיפול בתאי שריר חלקים של אבי העורקים בחולדה עם סולפוראפאן [105 ]. במודל של פגיעה כלייתית חריפה הנגרמת בניגוד, לאחרונה התגלה כי לשיפוץ איסכמי בגפיים יש השפעות מגן, כולל עיכוב של פתיחת ה- mPTP ונפיחות במיטוכונדריה, על ידי הפעלת Nrf2 כתוצאה מעיכוב GSK3? [106].

מיטופגיה, התהליך שבו המיטוכונדריה הלא מתפקדת נבלעת באופן סלקטיבי על ידי אוטופגוזומים ונמסרת לליזוזומים כדי להיות מושפלת ומחזור על ידי התא, חיונית להומאוסטזיס המיטוכונדריאלי [107], [108]. בעוד שלא נמצא קשר סיבתי בין Nrf2 למיטופגיה, ישנן עדויות לכך שגורם השעתוק עשוי להיות חשוב בבקרת האיכות המיטוכונדריאלית על ידי מילוי תפקיד במיטופגיה. זה עשוי להיות בולט במיוחד בתנאים של לחץ חמצוני. לפיכך, במודל של אלח דם, העליות ברמות הסמן האוטופגוזום MAP1 שרשרת אור 3-II (LC3-II) וחלבון המטען p62 ב 24 שעות לאחר ההדבקה מדוכאות ב- Nrf2-KO בהשוואה לעכברי WT [109] . לאחרונה התגלה אינדוקציה של מיטופגיה עם מולקולה קטנה (המכונה inducer mitophagy בתיווך p62, PMI); תרכובת 1,4-דיפניל-1,2,3-טריאזול זו תוכננה במקור כמפעיל Nrf2 המשבש את האינטראקציה של גורם השעתוק עם Keap1 [110]. בדומה לתאים בהם Nrf2 מוגדר גנטית (Keap1-KD או Keap1-KO), לתאים שנחשפו ל- PMI יש מנוחה גבוהה יותר? חשוב לציין, העלייה בלוקליזציה LC3 המיטוכונדריאלית שנצפית לאחר טיפול PMI בתאי WT אינה מתרחשת בתאי Nrf2-KO, מה שמעיד על מעורבות NRF2.

לבסוף, ניתוח ultrastructural של קטעי הכבד חשפה את נוכחותם של מיטוכונדריה נפוחה עם Crista מופחת וקרומי משבש hepatocytes של Nrf2-KO, אבל לא WT, עכברים כי היה מוזן דיאטה עתירת שומן עבור 24 שבועות; במיוחד, הכבדים האלה מראים ראיות ברורות של מתח חמצוני ודלקת [68]. ניתן להסיק כי Nrf2 יש תפקיד קריטי בשמירה על שלמות המיטוכונדריה בתנאים של לחץ חמצוני דלקתי.

Sulforaphane והשפעותיו על סרטן, תמותה, הזדקנות, מוח והתנהגות, מחלות לב ועוד

Isothiocyanates הם כמה תרכובות צמח החשוב ביותר שאתה יכול לקבל בתזונה. בסרטון זה אני עושה את המקרה המקיף ביותר עבור אותם כי היה אי פעם. טווח קשב קצר? דלג לנושא המועדף עליך על ידי לחיצה על אחת מנקודות הזמן הבאות. ציר זמן מלא להלן.

מקטעי מפתח:

  • 00: 01 - סרטן ותמותה
  • 00: 19 - הזדקנות
  • 00: 26: 30 - המוח וההתנהגות
  • 00: 38 - סיכום סופי
  • 00: 40 - מינון

ציר זמן מלא:

  • 00: 00: 34 - מבוא של sulforaphane, מוקד עיקרי של הסרטון.
  • 00: 01: 14 - הצריכה של הצומח הצמח והפחתת בתמותה מכל הסיבות.
  • 00: 02 - סיכון לסרטן הערמונית.
  • 00: 02 - סיכון לסרטן שלפוחית ​​השתן.
  • 00: 02 - סרטן הריאה אצל מעשנים מסתכן.
  • 00: 02 - סיכון לסרטן השד.
  • 00: Hypothetical: מה אם כבר יש לך סרטן? (התערבות)
  • 00: 03: 35 - מנגנון מתקבל על הדעת המניע את הנתונים התמותה הסרטן ותמותה.
  • 00: 04 - Sulforaphane וסרטן.
  • 00: 05: 32 - ראיות לבעלי חיים המראים השפעה חזקה של ברוקולי לנבוט לחלץ על התפתחות שלפוחית ​​השתן בעכברים.
  • 00: 06 - השפעת תוסף ישיר של sulforaphane בחולי סרטן הערמונית.
  • 00: 07: 09 - ביואקומולציה של מטבוליטים איסוציאיאנט ברקמת השד בפועל.
  • 00: 08: 32 - עיכוב של תאי גזע סרטן השד.
  • 00: 08: 53 - שיעור היסטוריה: brassicas הוקמו כבעלי תכונות בריאותיות גם ברומא העתיקה.
  • 00: 09 - היכולת של Sulforaphane כדי לשפר את הפרשת מסרטן (בנזין, acrolein).
  • 00: 09 - NRF51 כמתג גנטי באמצעות רכיבי תגובה נוגדי חמצון.
  • 00: 10 - כיצד NRF10 ההפעלה משפר הפרשת מסרטן באמצעות גלוטתיון- S-conjugates.
  • 00: 10: 34 - נבטים בריסל להגדיל גלוטתיון- S-transferase ולהפחית נזק ל- DNA.
  • 00: 11 - ברוקולי לנבוט משקה מגביר הפרשת בנזין על ידי 20%.
  • 00: 13: 31 - ברוקולי לנבוט homogenate מגביר אנזימים נוגדי חמצון בדרכי הנשימה העליונות.
  • 00: 15: צריכת הצליבה הצמחית ותמותה ממחלות לב.
  • 00: 16 - ברוקולי נובט אבקת משפר את רמת השומנים בדם ואת הסיכון למחלות לב כל סוג של חולי סוכרת מסוג 55.
  • 00: 19 - תחילת סעיף ההזדקנות.
  • 00: 19 - דיאטה עשירה ב- Sulforaphane משפרת תוחלת חיים של חיפושיות מ- 21 ל- 15% (בתנאים מסוימים).
  • 00: 20 - חשיבותה של דלקת נמוכה לאריכות ימים.
  • 00: 22: CROCiferous ירקות ברוקולי נבט אבקה נראה להקטין מגוון רחב של סמנים דלקתיים בבני אדם.
  • 00: 23: 40 - סיכום וידאו: סרטן, קטעים מזדקנים
  • 00: 24: 14 - מחקרים שנעשו על ידי עכברים מצביעים על כך ש- sulforaphane עשוי לשפר את תפקוד המערכת החיסונית הזקנה בגיל מבוגר.
  • 00: 25 - שיפור צבע השיער גדל במודל עכבר של מקריח. תמונה ב 18: 00: 26.
  • 00: 26 - התחלה של המוח והתנהגות סעיף.
  • 00: 27: 18 - השפעת ברוקולי לנבוט לחלץ על אוטיזם.
  • 00: 27: 48 - השפעת glucoraphanin על סכיזופרניה.
  • 00: 28: 17 - תחילת הדיון בדיכאון (מנגנון ומחקרים סבירים).
  • 00: 31 - מחקר עכבר באמצעות 21 דגמים שונים של לחץ המושרה על-ידי דיכאון הראה sulforaphane ביעילות דומה כמו fluoxetine (prozac).
  • 00: 32: 00 - מחקר מראה בליעה ישירה של glucoraphanin בעכברים הוא יעיל באופן דומה במניעת דיכאון מ תבוסה חברתית מודל הלחץ.
  • 00: 33 - תחילתו של קטע neurodegeneration.
  • 00: 33 - Sulforaphane ואלצהיימר.
  • 00: 33 - Sulforaphane ומחלת פרקינסון.
  • 00: 33 - Sulforaphane והונגטינגטון.
  • 00: 34: 13 - Sulforaphane מגביר את החלבונים בהלם חום.
  • 00: 34 - תחילתו של סעיף פגיעה מוחית טראומטית.
  • 00: 35: 01 - Sulforaphane מוזרק מיד לאחר TBI משפר זיכרון (מחקר העכבר).
  • 00: 35: 55 - Sulforaphane ופלסטיות עצבית.
  • 00: 36: 32 - Sulforaphane משפר את הלמידה במודל של סוכרת מסוג II בעכברים.
  • 00: 37: 19 - Sulforaphane ו Duchenne ניוון שרירים.
  • 00: 37: עיכוב מיוסטטין בתאי לווין שרירים (במבחנה).
  • 00 - 38: 06: סיבת וידאו מאוחרת: תמותה וסרטן, נזק ל- DNA, מתח חמצוני ודלקת, הפרשת בנזן, מחלות לב וכלי דם, סוכרת מסוג II, השפעות על המוח (דיכאון, אוטיזם, סכיזופרניה, ניוון מוחי), נתיב NRF2.
  • 00: 40 - מחשבות על חישוב מנה של נבטי ברוקולי או sulforaphane.
  • 00: 41: אנקדוטות על הנבטה בבית.
  • 00: על טמפרטורת בישול ופעילות sulforaphane.
  • 00: 43: 45 - חיידקי הבטן המרה של sulforaphane מ glucoraphanin.
  • 00: 44 - תוספי מזון טובים יותר בשילוב עם מירוזינאז פעיל מירקות.
  • 00: 44 - טכניקות בישול וירקות cruciferous.
  • 00: 46 - Isothiocyanates כמו goitrogens.
ד"ר חימנז לבן מעיל
Nrf2 הוא גורם שעתוק אשר ממלא תפקיד חשוב במערכת נוגדת החמצון הסלולרית של הגוף האנושי. אלמנט תגובה נוגדי חמצון, או ARE, הוא מנגנון הרגולציה של גנים. מחקרים רבים הוכיחו כי Nrf2, או NF-E2 הקשורים גורם 2, מסדיר מגוון רחב של גנים מונעים ARE ברחבי מספר סוגים של תאים. Nrf2 נמצא גם לשחק תפקיד חיוני להגנה הסלולר אנטי מסרטן, אשר מוכיח כי Nrf2 עשוי להיות טיפול יעיל בניהול של מחלות נוירודגנרטיב וסרטן האמינו כי נגרם על ידי מתח חמצוני. ד"ר אלכס Jimenez DC, תובנה CCST

הערות סיכום

למרות שאלות רבות עדיין נותרו פתוחים, הראיות הניסיוניות זמין עולה בבירור כי Nrf2 הוא שחקן חשוב בשמירה על הומאוסטזיס המיטוכונדריאלי שלמות מבנית. תפקיד זה הופך להיות קריטי במיוחד בתנאים של לחץ חמצוני, electrophilic, דלקתית כאשר היכולת upregulate Nrf2 בתיווך תגובות cytoprotective משפיע על הבריאות הכללית והישרדות של התא ואת האורגניזם. תפקידו של Nrf2 בתפקוד המיטוכונדריאלי מייצג עוד שכבה של מנגנוני הציטופרוטיב הרחבים המתואמים על ידי גורם שעתוק זה. כמו במקרים רבים פתולוגי אנושי יש מתח חמצוני, דלקת, תפקוד לקוי של המיטוכונדריה כמרכיבים חיוניים של הפתוגנזה שלהם, הפעלה פרמקולוגית של Nrf2 מחזיקה הבטחה למניעת מחלות וטיפול. הבנה מקיפה של המנגנונים המדויקים שבאמצעותם Nrf2 משפיעה על תפקוד המיטוכונדריה חיונית לתכנון רציונלי של ניסויים קליניים עתידיים, ויכולה להציע ביומרקרים חדשים לניטור יעילות טיפולית.

תודות

Sciencedirect.com/science/article/pii/S0891584915002129

מטרת המאמר לעיל הייתה לדון וכן להדגים את התפקיד המתהווה של Nrf2 בתפקוד המיטוכונדריה. Nrf2, או גורם גרעיני erythroid 2 הקשורים גורם, הוא מווסת מתפתח של עמידות תאית לחמצונים אשר יכול לתרום למתח חמצוני, המשפיע על תפקוד הסלולר ומוביל להתפתחות רעילות, מחלות כרוניות ואף סרטן. בעוד שייצור של חומרים מחמצנים בגוף האדם יכול לשרת מטרות שונות, כולל חלוקת תאים, דלקת, תפקוד חיסוני, אוטופגיה ותגובת לחץ, חשוב לשלוט בייצור יתר שלהם כדי למנוע בעיות בריאותיות. היקף המידע שלנו מוגבל לבעיות בריאות כירופרקטיקה ובעמוד השדרה. כדי לדון בנושא, אל תהסס לשאול את ד"ר חימנז או ליצור איתנו קשר בכתובת 915-850-0900 .

אושר על ידי ד"ר אלכס Jimenez

הפניה מ: Sciencedirect.com

לחצן התקשרות הירוק H. PNG

דיון בנושא נוסף: "כאבי גב חריפים

כאב גבזהו אחד הגורמים השכיחים ביותר לנכות וימי החמצה בעבודה ברחבי העולם. כאבי גב מייחסים את הסיבה השנייה בשכיחותה לביקורים במשרדי רופאים, שנמצאים במספרם רק בזיהומים בדרכי הנשימה העליונות. כ- 80 אחוז מהאוכלוסייה יחוו כאבי גב לפחות פעם אחת במהלך חייהם. עמוד השדרה הוא מבנה מורכב המורכב מעצמות, מפרקים, רצועות ושרירים, בין השאר רקמות רכות. מסיבה זו, פציעות ו / או מצבים מחמירים, כגון דיסקים, יכול בסופו של דבר להוביל לסימפטומים של כאבי גב. פציעות ספורט או פגיעות בתאונות דרכים הן לעיתים קרובות הגורם השכיח ביותר לכאבי גב, אולם לפעמים התנועות הפשוטות ביותר יכולות לגרום לתוצאות כואבות. למרבה המזל, אפשרויות טיפול אלטרנטיביות, כמו טיפול כירופרקטי, יכולות לעזור להקל על כאבי גב באמצעות התאמות בעמוד השדרה ומניפולציות ידניות, ובסופו של דבר לשפר את הקלה בכאב.

תמונה של הילד קריקטורה

EXTRA EXTRA | חשוב נושא: מומלץ אל Paso, TX Chiropractor

***

Nrf2 נתיב איתות: תפקידים מרכזיים בדלקת

Nrf2 נתיב איתות: תפקידים מרכזיים בדלקת

Nrf2 תומכת הפעלה של קבוצה של נוגדי חמצון ו אנזימים detoxifying ו גנים אשר להגן על הגוף האנושי מפני ההשפעות של בעיות בריאות הקשורות רמות מוגברת של מתח חמצוני, כגון מחלת אלצהיימר. מגוון של חומרים טבעיים הוכחו כדי להפעיל את נתיב Nrf2, אשר יכול לעזור לנהל את הסימפטומים של מחלות נוירודגנרטיבי. מטרת המאמר להלן היא לדון על תפקיד מרכזי של Nrf2 הנגרמת על ידי דלקת כרונית.

תַקצִיר

דלקת היא המאפיין השכיח ביותר של מחלות וסיבוכים כרוניים רבים, תוך מילוי תפקידים קריטיים בסרטן. מספר מחקרים הוכיחו כי Nrf2 תורם לתהליך האנטי דלקתי על ידי תזמור גיוס תאים דלקתיים ויסות ביטוי גנים באמצעות אלמנט התגובה נוגד החמצון (ARE). מסלול איתות Keap1 (חלבון הקשור ל- ECH) / Nrf2 (גורם 2 הקשור ל- NF-E45 p2) / ARE מווסת בעיקר את ביטוי הגנים האנטי דלקתיים ומעכב את התקדמות הדלקת. לכן, זיהוי הפיטוכימיקלים החדשים התלויים ב- Nrf2 הפך לנקודת מפתח בגילוי התרופות. בסקירה זו אנו דנים בחברי מסלול האות Keap1 / Nrf2 / ARE ובגנים שלו במורד הזרם, ההשפעות של מסלול זה על מודלים של בעלי חיים של מחלות דלקתיות, ודרכי מעבר עם מסלול ה- NF-? B. בנוסף אנו דנים גם בנושא ויסות הדלקת NLRP3 על ידי Nrf2. מלבד זאת, אנו מסכמים את התרחיש הנוכחי של התפתחות פיטוכימיקלים אנטי דלקתיים ואחרים המתווכים את מסלול האיתות Nrf2 / ARE.

מילות מפתח: Nrf2, Keap1, ARE, דלקות, מתח חמצוני, Phytochemical

קיצורים

Sciencedirect.com/science/article/pii/S0925443916302861#t0005

מבוא

דלקת היא תהליך מורכב המתרחש כאשר רקמות נגועים או נפגעים על ידי גירויים מזיקים כגון פתוגנים, נזק, או irritants. תאי החיסון, כלי הדם והמגשרים המולקולריים מעורבים בתגובת ההגנה הזו [1]. דלקת היא גם תופעה פתולוגית הקשורה למגוון מצבי מחלה הנגרמים בעיקר מגורמים פיזיים, כימיים, ביולוגיים ופסיכולוגיים. מטרת דלקת היא להגביל ולבטל את הגורמים לנזק הסלולר, לנקות ו / או לספוג תאים ורקמות נמק, וליזום תיקון רקמות. שתי צורות שונות של דלקת נבדלות: חריפה וכרונית. דלקת חריפה היא הגבלה עצמית מועילה למארח, אבל דלקת כרונית ממושכת היא תכונה נפוצה של מחלות כרוניות רבות וסיבוכים. חדירה ישירה של תאי חיסון מונונוגרפיים רבים כגון מונוציטים, מקרופאגים, לימפוציטים ותאי פלסמה, כמו גם ייצור של ציטוקינים דלקתיים, מובילה לדלקת כרונית. הוא זיהה כי דלקת כרונית משחק תפקיד קריטי קרצינוגנזה [2]. באופן כללי, שני מסלולי איתות פרו ואנטי דלקתיים פועלים בתהליכים דלקתיים נורמליים.

בתהליך הדלקתי הפתולוגי מופעלים תחילה תאי מאסט, מונוציטים, מקרופאגים, לימפוציטים ותאי חיסון אחרים. ואז התאים מגויסים לאתר הפציעה, וכתוצאה מכך נוצרים מינים של חמצן תגובתי (ROS) הפוגעים במקרומולקולות כולל DNA. יחד עם זאת, תאים דלקתיים אלה מייצרים כמויות גדולות של מתווכים דלקתיים כמו ציטוקינים, כימוקינים ופרוסטגלנדינים. מתווכים אלה מגייסים עוד מקרופאגים לאתרי דלקת מקומיים ומפעילים ישירות מפל התמרה של אותות רבים וגורמי שעתוק הקשורים לדלקת. מסלולי איתות NF-? B (גורם גרעיני kappa B), MAPK (חלבון קינאז המופעל על ידי המיטוגן) ו- JAK (janus kinase) -STAT (מתמרי אות ומפעילי שעתוק) מעורבים בפיתוח המסלול הקלאסי של דלקת. [3], [4], [5]. מחקרים קודמים גילו כי גורם השעתוק Nrf2 (NF-E2 p45 הקשורים לגורם 2) מווסת את הביטוי של אנזימים לניקוי רעלים בשלב II, כולל NADPH, NAD (P) H quinone oxidoreductase 1, גלוטתיון פרוקסידאז, פריטין, heme oxygenase-1 (HO -1), וגנים נוגדי חמצון המגנים על תאים מפגיעות שונות באמצעות השפעותיהם האנטי דלקתיות, ובכך משפיעים על מהלך המחלה [6], [7], [8].

בהתחשב בממצאים המדהימים הללו, ההתפתחות של תרופות טיפוליות ממוקדות למחלות דלקתיות באמצעות מסלולי איתות עוררה עניין רב בשנים האחרונות. בסקירה זו, אנו מסכמים את המחקר על Keap1 (Kelch כמו ECH הקשורים חלבון) / Nrf2 (NF-E2 p45 הקשורים גורם 2) / ARE (נוגד חמצון תגובה רכיב) מסלול איתות דלקת.

מבנה והסדרת Nrf2

Keap1-תלוי Nrf2 תקנה

Nrf2 שייך לתת-משפחת ה- Coll Capn Collar (CNC) והוא כולל בשבעה תחומים פונקציונליים, Neh (Nrf2-ECH homology) 1 ל- Neh7 [9], [10]. Neh1 הוא תחום CNC-bZIP המאפשר ל- Nrf2 להתמקד עם חלבון פיברוסקומפוטו שרירי קטן (Maf), DNA ושותפי שעתוק אחרים וכן ליצור קומפלקס גרעיני עם האנזים מצומצם יוביקוויטין UbcM2 [11], [12]. Neh2 מכיל שני מוטיבים חשובים המכונים DLG ו- ETGE, החיוניים לאינטראקציה בין Nrf2 לבין הרגולטור השלילי שלה Keap1 [13], [14].

KeapXNXX הוא מתאם המצע עבור cigin מבוסס exnumx ubiquitin ligase, אשר מעכב את פעילות תעתיק של Nrf1 דרך ubiquitination ו השפלה proteasomal בתנאים רגילים [3], [2], [15]. תחומים KELCH של ההומודימר Kep16 להיקשר עם מוטיבים DLG ו ETGE של Nrf17-Neh1 תחום cytosol, שם ETGE פועל כציר עם זיקה גבוהה יותר ו- DLG מעשים כמו נעילה [2]. תחת לחץ oxidative או על החשיפה Nrf2 activators, Nrf18 disociates מ Keap2 מחייב עקב שינוי thiol של שאריות ציסטאין Keap2 אשר בסופו של דבר מונע Nvf1 ubiquitination ו השפלה proteasomal [1]. ואז Nrf2 translocates לתוך הגרעין, heterodimerizes עם חלבונים המאפיה קטן, ו transactivates סוללת ARE של גנים (איור 19A). מסוף carboxy של Neh2 פועל כמו תחום transactivation ידי אינטראקציה עם שעתוק co-activator הידועה בשם CHD1 (chromo-ATPase / helicase DNA חלבון מחייב) [3]. Neh6 ו Neh20 גם לשמש תחומים transactivation, אבל להיקשר עוד תמליל שיתוף activator הידועה בשם CBP (CAMP-Response- מחייב חלבון מחייב חלבון חלבון) [4]. יתר על כן, Neh5 ו Neh21 אינטראקציה עם cofactor גרעיני RAC4 / AIB5 / SRC-3, המוביל משופר Nrf1 ממוקד ARE ביטוי גנים [3]. ל- Neh2 יש אות יצוא גרעיני רגיש לחידוש, שהוא חיוני עבור הרגולציה והלוקליזציה הסלולרית של Nrf22 [5].

איור 1 Keap1 תלויים ו-תקנה עצמאית של Nrf2. (א) בתנאים בסיסיים, Nrf2 הוא מסודר עם Keap1 על ידי שני המוטיבים שלו (ETGE ו- DLG) המוביל לליווי בכל מקום בתיווך CUL3 ואחריו השפלה של פרוטאזום. תחת לחץ חמצוני, Nrf2 מתנתק מ- Keap1, מתנשא לגרעין ומפעיל את סוללת ה- ARE. (B) GSK3 זרחן Nrf2 וזה מאפשר את ההכרה של Nrf2 על ידי? -TrCP עבור CUL1 בתיווך CUB62 והשפלה פרוטאזום שלאחר מכן. (C) p1 מועבר עם Keap2, מה שמוביל להשפלתו האוטופגית, לשחרור ה- Nrf2 ולהגברת האותות NrfXNUMX.

Kep1- עצמאית Nrf2 תקנה

עדויות מתגלות גילו מנגנון חדש של ויסות Nrf2 שאינו תלוי ב- Keap1. תחום ה- Neh6 העשיר בסרין של Nrf2 ממלא תפקיד מכריע בוויסות זה על ידי קשירה עם שני המוטיבים שלו (DSGIS ו- DSAPGS) לחלבון המכיל חזרה על -transducin (? -TrCP) [24]. ? -TrCP הוא קולטן מצע למתחם Skp1 Cul1 Rbx1 / Roc1 ubiquitin ligase שמכוון ל- Nrf2 לצורך היווצרות מקום והשפלה פרוטאזומלית. גליקוגן סינתאז קינאז -3 הוא חלבון מכריע המעורב בייצוב ויסות Nrf1 עצמאי ב- Keap2; זה זרחן Nrf2 בתחום Neh6 כדי להקל על ההכרה של Nrf2 על ידי? -TrCP ופירוק חלבונים שלאחר מכן [25] (איור 1B).

אחרים Nrf2 הרגולטורים

שורה נוספת של ראיות חשפה מסלול לא קאנוני של pxNUMX תלוי Nrf62 ההפעלה שבה p2 סקסטרים Keap62 כדי השפלה autophagic כי בסופו של דבר מוביל ייצוב של Nrf1 ו transactivation של גנים Nrf2 תלויים [2], [26], [ 27], [28] (איור 29C).

עדויות מצטברות מצביעות על כך שמספר מירנות ממלאים תפקיד חשוב בהסדרת הפעילות Nrf2 [30]. סנגוקויה ואח '. [31] הוכיח כי miR-144 מוריד באופן ישיר את פעילות ה- Nrf2 בקו התאים הלימפובלסט K562, תאי אב קדומים של אריתרואיד אנושיים ורטיקולוציטים של מחלת מגל. מחקר מעניין נוסף בתאי אפיתל של השד האנושי הוכיח כי miR-28 מעכב את Nrf2 באמצעות מנגנון עצמאי של Keap1 [32]. באופן דומה, מירנות כמו miR-153, miR-27a, miR-142-5p ו- miR144 מווסתות את הביטוי Nrf2 במורד קו בשורת התא העצבית SH-SY5Y [33]. סינג ואח '. [34] הוכיח כי הביטוי האקטופי של miR-93 מקטין את הביטוי של גנים המווסתים ב- Nrf2 במודל עכברוש המושרה על ידי עכבר של 17? אסטרדיול (E2) של סרטן החלב.

תגלית שנערכה לאחרונה ממעבדתנו זיהתה מעכב אנדוגני של Nrf2 הידוע כ- RXR? RXR? הוא קולטן גרעיני, מקיים אינטראקציה עם התחום Neh7 של Nrf2 (שאריות חומצות אמיניות 209 316) באמצעות התחום המקשר ל- DNA שלו (DBD), ומעכב באופן ספציפי את פעילות ה- Nrf2 בגרעין. יתר על כן, דווח כי קולטנים גרעיניים אחרים כמו קולטן המופעל על ידי פרוליזור-מופעל- ER, ER ?, קולטן הקשור לאסטרוגן- וקולטני גלוקוקורטיקואידים הם מעכבים אנדוגניים לפעילות Nrf2 [9], [10].

אנטי דלקתי תפקיד של Nrf2 / HO-1 ציר

HO-1 הוא האיזופור המושרה והגבלת הגבלת האנזים המזרז את ההשפלה של heme לתוך פחמן חד חמצני (CO) ו ברזל חינם, biliverdin כדי bilirubin. השפלה אנזימטית של heme חינם דלקתית Pro כמו גם ייצור של חומרים אנטי דלקתיים כגון CO ו bilirubin לשחק תפקידים מרכזיים בשמירה על ההשפעות המגנות של HO-1 (איור 2).

איור 2 סקירה של נתיב Nrf2 / HO-1. בתנאים בסיסיים, Nrf2 נקשר לדיכאון Keap1 שלו, מה שמוביל לכל מקום ואחריו השפלה של פרוטאזום. במהלך לחץ חמצוני, Nrf2 חופשי מתחלף לגרעין, שם הוא מתעמעם עם בני משפחת המאף הקטנה ונקשר לגני ARE כגון HO-1. HO-1 מווסת מזרז את ההם ל- CO, בילירובין וברזל חופשי. CO פועל כמעכב מסלול ה- NF-? B המוביל לירידה בביטוי של ציטוקינים פרו-דלקתיים, ואילו בילירובין משמש גם כנוגד חמצון. יתר על כן, HO-1 מעכב ישירות את הציטוקינים הקדם-דלקתיים, כמו גם את הפעלת הציטוקינים האנטי-דלקתיים, ובכך מוביל לאיזון בין התהליך הדלקתי.

Nrf2 גורם לגן HO-1 על ידי הגדלת ביטוי ה- mRNA והחלבון והוא אחד הגן הקלאסי המווסת של Nrf2 אשר נמצא בשימוש נרחב במספר מחקרים חוץ גופיים ו- in vivo. מספר מחקרים הראו כי ל- HO-1 ולמטבוליטים שלו השפעות אנטי-דלקתיות משמעותיות בתיווך Nrf2. העלאת הביטוי של HO-1 המתווכת על ידי Nrf2 מופעלת מובילה לעיכוב של איתות NF? B גורם לפגיעה מופחתת ברירית המעי ולתפקוד לקוי של צומת הדוק במודל השתלת כבד עכברוש Sprague-Dawley [35]. ויסות יתר של ביטוי HO-2 תלוי Nrf1 עשוי להגן על מיובלסטים C2C12 שמקורם בעכבר מפני רעילות ציטוטית של H2O2 [36]. ל- HO-2 תלוי Nrf1 יש השפעה על תגובות דלקתיות ליפופוליסכרידיות (LPS) בתגובות דלקתיות בתאי קצף RAW264.7 או עכבר הצפקי מקרופאג. פעילות Nrf2 של פנוטיפ מקרופאגים של תאי קצף חסרת רגישות ומונעת דלקת לא מתונה של מקרופאגים, אלה ממלאים תפקיד חשוב בהתקדמות של טרשת עורקים [37]. ציר Nrf2 / HO-1 משפיע על תאי מיקרוגלג'י עכברים המושרשים על ידי LPS ותאי HT2 בהיפוקמפוס העכבר, עם השפעה על דלקת עצבית. ויסות-ביטוי של ביטוי HO-22 דרך מסלול Nrf1 בתאי מיקרו-גליל עכבריים BV2 המגנים על מוות תאים של תאי HT2 בהיפוקמפוס העכבר [22]. יתר על כן, מולקולות היברידיות מבוססות קובלט (HYCO) המשלבות גורם מזריק Nrf38 עם משחרר פחמן חד חמצני (CO) מגבירות את הביטוי Nrf2 / HO-2, משחררות CO ומפעילות פעילות אנטי דלקתית במבחנה. HYCOs גם מווסתים את הרקמה HO-1 ומספקים CO בדם לאחר מתן in vivo, ותומכים בשימוש הפוטנציאלי שלהם כנגד מצבים דלקתיים [1]. רגולציה של Nrf39 / HO-2 מפחיתה דלקת על ידי הגברת הפעילות האפרוציטית של מקרופאגים עכבריים שטופלו בכלוראינים של טאורין [1]. בסך הכל, מודלי הניסוי שהוסברו לעיל גילו כי ציר Nrf40 / HO-2 ממלא תפקיד מרכזי בתפקוד האנטי-דלקתי, מה שמרמז כי Nrf1 הוא יעד טיפולי במחלות הקשורות לדלקת.

בנוסף, תוצרי הלוואי של HO-1 כגון CO, bilirubin, משמשים כחומרים נוגדי חמצון רבי עוצמה במהלך לחץ חמצוני ונזק לתאים [41], [42]; זה מדכא דלקת ריאות אוטואימונית וצהבת [43], [44]; והוא מגן על עכברים וחולדות נגד הלם האנדוטוקסי על ידי מניעת הדור של iNOS ו- NO [45], [46], [47]. יתר על כן, Bilirubin מפחית הפעלה אנדותל ותפקוד לקוי [48]. מעניין, bilirubin מפחית את transmigration של ליקוציטים אנדותל באמצעות מולקולה הידבקות- 1 [49]. אלה הפניות ספציפיות המציין לא רק HO-1 מעשים כמו סוכן אנטי דלקתי חזק אבל גם מטבוליטים שלה.

מתווכים דלקים ואנזימים מעוכבים על ידי Nrf2

ציטוקינים וכימוקינים

ציטוקינים הם חלבונים ופוליפפטידים בעלי משקל מולקולרי נמוך המופרשים על ידי מגוון תאים; הם מווסתים את צמיחת התאים, ההבחנה והתפקוד החיסוני, והם מעורבים בדלקת וריפוי פצעים. ציטוקינים כוללים אינטרלוקינים (IL), אינטרפרונים, גורם נמק בגידול (TNF), גורם מגרה מושבה, כימוקינים וגורמי גדילה. חלק מהציטוקינים נחשבים כמתווכים פרו-דלקתיים ואילו לאחרים יש פונקציות אנטי-דלקתיות. חשיפה למתח חמצוני גורמת לייצור יתר של ציטוקינים הגורם למתח חמצוני בתאי היעד. מספר ציטוקינים פרו-דלקתיים מיוצרים יתר על המידה כאשר NF-? B מופעל על ידי מתח חמצוני. יתר על כן, לחץ חמצוני פרו-דלקתי גורם להפעלה נוספת של NF-? B ולייצור יתר של ציטוקינים. הפעלת מערכת Nrf2 / ARE ממלאת תפקיד חשוב בשיבוש מחזור זה. כימוקינים הם משפחה של ציטוקינים קטנים שתפקידם העיקרי הוא להנחות את נדידת התאים הדלקתיים. הם מתפקדים בעיקר כחומרים כימותרפיים עבור לויקוציטים, מונוציטים, נויטרופילים ותאי אפקטור אחרים.

נמסר כי הפעלה של Nrf2 מונעת ויסות תעתיק המושרה על ידי LPS של ציטוקינים פרו-דלקתיים, כולל IL-6 ו- IL-1? [50]. IL-1? וייצור IL-6 גדל גם ב- Nrf2? /? עכברים עם קוליטיס המושרה על ידי דקסטרן סולפט [51], [52]. Nrf2 מעכב ייצור של IL-17 במורד הזרם וגורמים דלקתיים אחרים Th1 ו- Th17, ומדכא את תהליך המחלה במודל ניסיוני של טרשת נפוצה, דלקת מוח אוטואימונית [53]. הגנים נוגדי החמצון התלויים Nrf2 HO-1, NQO-1, Gclc ו- Gclm חוסמים TNF- ?, IL-6, חלבון אטרקטיבי כימי מונוציטים -1 (MCP1), חלבון דלקתי מקרופאג -2 (MIP2) ודלקתי. מגשרים. אך במקרה של עכברי Nrf2-knockout, ההשפעה האנטי-דלקתית אינה מתרחשת [54]. לנויטרופילים פריטונאליים מעכברים מסוג Nrf2-knockout שטופלו ב- LPS יש רמות גבוהות משמעותית של ציטוקינים (TNF-? ו- IL-6) וכימוקינים (MCP1 ו- MIP2) מאשר תאי wild-type (WT) [54]. במבחנה, העברת הגן Nrf2 לתאי שריר חלק אבי העורקים של העורקים האנושיים והארנביים מדכאת את ההפרשה של MCP1 [8], [55], וביטוי HO-2 תלוי ב- Nrf1 מדכא את ה- TNF -? - מגורה ב- NF-? B ו- MCP-1 הפרשה בתאי אנדותל של וריד הטבור [56]. ממצאים אלה רומזים כי בתגובה לגירויים דלקתיים, ויסות מעלים של איתות Nrf2 מעכב ייצור יתר של ציטוקינים וכימוקינים פרו-דלקתיים וכן מגביל את הפעלת NF-? B.

מולקולות הדבקת תאים

מולקולות הידבקות בתאים (CAM) הן חלבונים הנקשרים עם תאים או עם המטריצה ​​החוץ תאית. הם ממוקמים על פני התא, והם מעורבים בזיהוי תאים, הפעלת תאים, העברת אותות, התפשטות והתמיינות. בין ה- CAMs, ICAM-1 ו- VCAM-1 הם חברים חשובים במשפחת העל האימונוגלובולינים. ICAM-1 קיים בריכוזים נמוכים בקרומי תאי האנדותל. עם גירוי ציטוקינים, הריכוז עולה משמעותית. ICAM-1 יכול להיגרם על ידי IL-1 ו- TNF ומתבטא באנדותל כלי הדם, מקרופאגים ולימפוציטים. זהו ליגנד לאינטגרין, קולטן המצוי בלוקוציטים. כאשר מופעל גשר ICAM-1-integrin, לוקוציטים נקשרים לתאי אנדותל ואז נודדים לרקמות תת-אנדותל [57]. VCAM-1 מתווך הידבקות של לימפוציטים, מונוציטים, אאוזינופילים ובזופילים לאנדותל כלי הדם ותורם לגיוס לויקוציטים, מה שמוביל בסופו של דבר לפגיעה ברקמות עקב לחץ חמצוני. Nrf2 מעכב את פעילות היזם של VCAM-1 [58]. הגן במורד הזרם המוסדר Nrf2 HO-1 יכול להשפיע על הביטוי של E-selectin ו- VCAM-1, מולקולות הידבקות הקשורות לתאי אנדותל [59]. הביטוי הריאתי של מספר CAMs כמו CD-14, TREM1, SELE, SELP ו- VCAM-1 גבוה משמעותית ב- Nrf2? /? עכברים מאשר בעכברים Nrf2 + / + [60]. Nrf2 בתאי אנדותל אבי העורקים האנושיים מדכאים את ביטוי ה- VCAM-1 המושרה על ידי TNF - ומפריעים להידבקות תאים מונוציטית U937 מונוציטית של TNF - 8 [2]. ביטוי יתר של Nrf1 מעכב גם את ביטוי הגן VCAM-61 המושרה על ידי TNF -? בתאי האנדותל של כלי הדם האנושיים [3]. נוגד החמצון הטבעי 1-hydroxyanthranilic (HA), אחד ממטבוליטים l-tryptophan שנוצרו in vivo לאורך המסלול המטבולי המכונה מסלול kynurenine במהלך דלקת או זיהום, נמצא כגורם לביטוי HO-2 וממריץ Nrf2 בטבור אנושי. תאי אנדותל הוורידים (HUVEC). ביטוי HO-1 תלוי Nrf1 המושרה על ידי HA מעכב הפרשת MCP-1, ביטוי VCAM-56 והפעלת NF-kB הקשורים לפגיעה בכלי הדם ולדלקת בטרשת עורקים [2]. נגזרת הכלקון הסינתטי האנטי-שגשתי והאנטי-דלקתי 4?, 6?, 1? -טריס (metoxymethoxy) כלקון מעכב ICAM-1, הציטוקין הפרו-דלקתי IL-62 ?, ו- TNF-? ביטוי ברקמת המעי הגס מעכברים שטופלו בחומצה סולפונית טריניטרובנזן [2]. ויסות מחדש של Nrf1 מעכב את ביטוי ה- ICAM-63 המושרה על ידי TNF -? - בתאי אפיתל פיגמנט ברשתית אנושיים שטופלו בליקופן [2]. כל המחקרים הללו מצביעים על כך ש- NrfXNUMX ממלא תפקיד מפתח בתהליך הדלקתי על ידי ויסות נדידתם וחדירתם של תאי דלקת לרקמה מודלקת.

מטריקס Metalloproteinases (MMPs)

MMPs נמצאים באופן נרחב במטריקס החוץ-תאי ומעורבים בתהליכים פיזיולוגיים ופתולוגיים כגון התפשטות תאים, הגירה, בידול, ריפוי פצעים, אנגיוגנזה, אפופטוזיס וגרורות בגידול. דווח כי ציר ה- Nrf2 / HO-1 מעכב את MMP-9 במקרופאגים ו- MMP-7 בתאי אפיתל במעי אנושי, וזה מועיל לטיפול במחלות מעי דלקתיות [62], [64]. נזק לעור המושרה על ידי קרינת UV הוא חמור יותר בנוק-אאוט Nrf2 מאשר בעכברי WT ורמת ה- MMP-9 גבוהה משמעותית, מה שמעיד כי Nrf2 מפחית את הביטוי של MMP-9. לכן, Nrf2 נחשב כמגן מפני הקרנת UV [65]. מחקר אחר דיווח גם כי הפעלת תעתיק מווסתים של MMP-9 בפלישת תאי גידול ודלקת מוסדרת באמצעות עיכוב מסלול האיתות NF-kB [66]. בפגיעה טראומטית בעמוד השדרה, מסלול האיתות NF-kB לוקח גם חלק בוויסות רמות ה- mRNA של MMP-9 [67]. לכן, בדלקת הרגולציה של MMP מושפעת ישירות ממסלול Nrf2 או בעקיפין דרך מסלול ה- NF-? B המושפע מ- Nrf2.

Cyclooxygenase-2 (COX2) ו Inducible תחמוצת החנקן סינתזה (INOS)

סדרת ניסויים בעכברים מסוג Nrf2-knockout הוכיחו את תפקידם המכריע בדלקת ובוויסות גנים פרו-דלקתיים כגון COX-2 ו- iNOS. לראשונה, Khor et al. דיווחו על ביטוי מוגבר של ציטוקינים פרו-דלקתיים כמו COX-2 ו- iNOS ברקמות המעי הגס של Nrf2? /? עכברים בהשוואה לעכברי WT Nrf2 + / +, דבר המצביע על כך ש- Nrf2 מדכא את פעילותם [51]. דיווח נוסף על טיפול מקדים עם סולפוראפאן, אחד מפעילי ה- Nrf2 הידועים שנמצאים בירקות מצליבים, הדגים את השפעתו האנטי-דלקתית של עיכוב הביטוי של TNF-, IL-1, COX-2 ו- iNOS בשני ה- mRNA. ורמות חלבון במקרופאגים פריטוניאליים ראשוניים מעכברים Nrf2 + / + בהשוואה לאלה מ- Nrf2? /? עכברים [68]. באופן דומה, ההיפוקמפוס של עכברים מסוג Nrf2-knockout עם דלקת הנגרמת על ידי LPS מראה גם ביטוי גבוה יותר של סמני דלקת כגון iNOS, IL-6 ו- TNF-? מאשר עכברי WT [69]. כמו כן, עכברי Nrf2 נוקאאוט רגישים יתר למתח החמצוני המושרה על ידי 1-מתיל-4-פניל-1,2,3,6-טטרה-הידרופירידין וכן מראים רמות מוגברות של mRNA וחלבון של סמני דלקת כגון COX-2, iNOS. , IL-6 ו- TNF-? [70]. יתר על כן, כבדים מ- Nrf2? /? לעכברים המאותגרים בדיאטה עם חסר במתיונין ובכולין יש ביטוי mRNA גבוה יותר פי 5 של Cox2 ו- iNOS בהשוואה לאלו של עכברי WT באותה תזונה, דבר המצביע על תפקיד אנטי דלקתי של Nrf2 [71]. לאחרונה, קים ואח '. הוכיח כי פירובט האתיל הפיטוכימי מפעיל את השפעותיו האנטי דלקתיות ונוגדות החמצון על ידי הפחתת הביטוי של iNOS באמצעות איתות Nrf2 בתאי BV2. הם הראו כי אתיל פירובט גורם לטרנסלוקציה גרעינית של Nrf2, מה שבסופו של דבר מעכב את האינטראקציה בין p65 ל- p300, מה שמוביל לירידה בביטוי של iNOS [72]. יתר על כן, האנלוגיה של קרבזול LCY-2-CHO מפעילה את Nrf2 וגורמת לטרנסלוקציה גרעינית שלו, מה שמוביל לדיכוי ביטוי COX2 ו- iNOS [73] בתאי שריר חלק עורקי העורקים בחולדות.

התפקיד הפרדוקסלי של Nrf2 בהסדרת ה- NLRP3 iIflammasome פעילות

משפחת ה- NLR, תחום הפירין המכיל דלקת דלקת 3 (NLRP3) הוא קומפלקס מולטי-פרוטאין המתפקד כקולט זיהוי פתוגן (PRR) ומזהה את המגוון הרחב של אותות לחץ חיידקיים, כגון דפוסים מולקולריים הקשורים לפתוגן (PAMPs), נזק- מולקולות דפוס מולקולריות קשורות (DAMPs) ו- ROS [74]. דלקת הדלקת NLRP3 המופעלת מתווכת את המחשוף של קספאז -1 והפרשת ציטוקינים אינטרלוקינים -1 פרו-דלקתיים? (IL-1?) שבסופו של דבר גורם לתהליך של מוות של תאים המכונה פירופטוזיס המגן על מארחים מפני מגוון רחב של פתוגנים [75]. עם זאת, הפעלה חריגה של הדלקת קשורה למחלות של קיפול מוטעה של חלבונים כמו אנצפלופתיה ספוגיפורמית מועברת, מחלת אלצהיימר, מחלת פרקינסון וגם סוכרת מסוג 2 [76], סרטן [77], צנית וטרשת עורקים [78].

תצפית שנערכה לאחרונה מקבוצת רונג הו על קשר בין Nrf2 לוויסות שלילי של דלקת הריאות העלתה כי, Nrf2 גורם לביטוי NQO1 שמוביל לעיכוב של הפעלת דלקת NLRP3, מחשוף קספאז -1 ו- IL-1? דור במקרופאגים. יתר על כן, מפעיל Nrf2 ידוע, tert-butylhydroquinone (tBHQ) מווסת שלילית תעתיק NLRP3 על ידי הפעלת ה- ARE באופן תלוי ב- Nrf2 [79]. בנוסף לתצפית הנ"ל, אותה קבוצה התגלה גם כי דימתיל פומרט (DMF) מונע קוליטיס המושרה על ידי DSS באמצעות הפעלת מסלול איתות Nrf2 המעורב בתעתוק גרעיני Nrf2 ועיכוב הרכבת דלקת NLRP3 [80].

סדרת ניסויים באמצעות תרכובות טבעיות וסינתטיות חשפה גם את ההשפעה המעכבת של Nrf2 על הפעלת דלקת NLRP3. לדוגמא, טיפול באפיגאלוקאטכין -3-גאלאט (EGCG) בעכברי נופריטיס של זאבת הוכיח כי הפחתת ההפעלה של דלקת NLRP3 בכליות מתווכת על ידי מסלול איתות Nrf2 [81]. כמו כן, ציטראל (3,7-דימתיל-2,6-אוקטדיאנל), תרכובת פעילה עיקרית בתרופות צמחיות סיניות Litsea cubeba, מעכב את הפעלת הדלקת NLRP3 באמצעות מסלול איתות נוגד חמצון Nrf2 במודל עכבר מואץ ולופוס זאבת (ASLN). [82]. באופן דומה, ביוכנין מוגן מפני פגיעת כבד הנגרמת על ידי LPS / GalN על ידי הפעלת מסלול Nrf2 ועיכוב הפעלת דלקת NLRP3 בעכברי BALB / c גברים [83]. יתר על כן, מנגיפרין הוצג גם כמווסת את הביטוי של Nrf2 ו- HO-1 באופן תלוי מינון ומעכב LPS / D-GalN המושרה בכבד NLRP3, ASC, caspase-1, IL-1? ו- TNF-? ביטוי [84].

למרות הוויסות השלילי של NLRP3 על ידי Nrf2, הוא גם מפעיל את פונקציית הדלקת NLRP3 ו- AIM2. האיטאו ון ועמיתיו גילו כי, Nrf2? /? מקרופאגים בעכבר הראו הפעלה לקויה של ה- NLRP3 ו- AIM2 Inflammasome אך לא של ה- inflammatorium NLRC4 [85]. מעניין לציין כי תצפית זו מתארת ​​את הפונקציות הלא ידועות של Nrf2 בהקשר למחלות הקשורות לדלקת; לפיכך חשוב מאוד ללמוד עוד על מנת לחשוף את המנגנון בו Nrf2 מפעיל את תפקוד הדלקת לפני שנחשב בו כמטרה טיפולית.

דיכוי של תעתיק ציטוקינים פרו דלקתיים על ידי Nrf2

תחקיר עדכני מאוד שהתבסס על אימונופרויטפולציה של כרומטין (ChIP) -sq ו- ChIP-qPCR הביא למקרופאגי עכברים גילה כי Nrf2 נקשר לאזורי היזם של ציטוקינים פרו-דלקתיים כגון IL-6 ו- IL-1? ומעכב גיוס RNA Pol II. כתוצאה מכך, RNA Pol II אינו מסוגל לעבד את הפעלת התעתיק של IL-6 ו- IL-1? שבסופו של דבר מוביל לעיכוב של ביטוי גנים. לראשונה, הקבוצה של Masayuki Yamamoto חשפה את המנגנון החדש שבאמצעותו Nrf2 לא רק מפעיל מחדש את הגנים במורד הזרם באמצעות AREs אלא גם מדכא את הפעלת התעתיק של גנים ספציפיים עם או בלי ARE באמצעות עיכוב גיוס ה- RNA Pol II [50].

מעבר בין מסלולים Nrf2 ו- NF-? B

NF-? B הוא קומפלקס חלבון האחראי על תעתיק DNA שנמצא כמעט בכל סוגי התאים של בעלי החיים ומעורב בתהליכים שונים כמו דלקת, אפופטוזיס, התגובה החיסונית, צמיחת תאים והתפתחות. ל- p65, חלבון Rel ממשפחת NF-? B, יש תחום פעיל, ואילו ל- p50 אין צורך ודורש הטרודימריזציה עם חלבון Rel להפעלת תעתיק. במהלך לחץ חמצוני מופעל I? B קינאז (IKK) וגורם לזירחון של I? B, וכתוצאה מכך שחרור וטרנסלוקציה גרעינית של NF-? B. NF-? B גורם לשעתוק של מתווכים פרו-דלקתיים כמו IL-6, TNF- ?, iNOS, IL-1, והידבקות תאית COX-2.

ויסות חריג של NF-? B נקשר לדלקת מפרקים שגרונית, אסטמה, מחלות מעי דלקתיות ודלקת קיבה המושרה בזיהום בהליקובקטר פילורי [86]. כיום נחשב שפעילות NF-kB משפיעה על מסלול האיתות Keapl / Nrf2 / ARE בעיקר בשלושה היבטים: ראשית, Keap1 משפיל את IKK? באמצעות ייצוא-מקום, ובכך מעכב את הפעילות של NF-? B [87]. שנית, התהליך הדלקתי גורם למתווכים דלקתיים כמו COX2 שמקורם ב- cyclopentenone prostaglandin 15d-PGJ2, אלקטרופיל חזק המגיב עם Keap1 ומפעיל את Nrf2, ובכך יוזם שעתוק גנים עם עיכוב בו זמנית של פעילות NF-kB [58], [88] ( איור 3 א, ב). שלישית, NF-? B יכול לשלב עם ה- CBF [2], [89] תחרותית תעתיקית מסוג NRf90 (איור 3 C, D).

איור 3 מעבר בין המסלולים Nrf2 ו- NF-? B. (א) Keap1 מכוון את ה- IKK לביו-קיום בתיווך CUL3 והשפלה של פרוטאזום, מה שמוביל בסופו של דבר לעיכוב של זרחון NF-? B ומנגנון זה פועל גם ככריכה תחרותית של Nrf2 ו- IKK עם Keap1. (ב) מתח חמצוני מפעיל את IKK שמזרחן את NF-? B, מה שמוביל לטרנסלוקציה שלו לגרעין ולהפעלת ציטוקינים דלקתיים כגון COX-2. המוצר הסופי של COX-2 המכונה 15d-PGJ2 משמש כמשרה של Nrf2 המוביל בסופו של דבר לדיכוי מתח חמצוני. (ג) Nrf2 נקשר עם קופקטור התעתיק שלו CBP יחד עם מאף קטן ומכונות תעתיק אחרות ליזום ביטוי גנים מונע ARE. (ד) כאשר NF-? B נקשר עם CBP בצורה תחרותית, זה מעכב את קשירת CBP עם Nrf2, מה שמוביל לעיכוב של הפעלה מחדש של Nrf2.

ההנחה היא כי מסלולי האיתות Nrf2 ו- NF-? B מתקשרים כדי לשלוט בתעתיק או בתפקוד של חלבוני יעד במורד הזרם. בהצדקה להנחה זו דוגמאות רבות מראות כי הפעלה ועיכוב ישירים או עקיפים מתרחשים בין חברי המסלולים Nrf2 ו- NF-? B (איור 4). בתגובה ל- LPS, מציאת Nrf2 מגדילה באופן משמעותי את פעילות תעתיק ה- NF-? B ואת תעתיק הגן התלוי ב- NF-? B, ומראה כי Nrf2 מעכב את פעילות ה- NF-? B [60], [91]. בנוסף, ביטוי מוגבר למורד הזרם HO-2 תלוי Nrf1 מעכב פעילות NF-? B. כאשר תאי סרטן הערמונית נחשפים לזמן קצר ל-? -טוכופריל סוצינאט, נגזרת של ביטוי ויטמין E, HO-1 מוגדרת. תוצרי הקצה של HO-1 מעכבים את הטרנסלוקציה הגרעינית של NF-? B [92]. אלה מחקרים vivo עולה כי Nrf2 שלילי מסדיר את נתיב איתות NF-kB. LPS מגרה פעילות קשירת DNA של NF-? B ורמת יחידת המשנה p65 של NF-? B גבוהה משמעותית בתמציות גרעיניות מהריאות של Nrf2? /? מאשר מעכברי WT, דבר המצביע על תפקיד שלילי של Nrf2 בהפעלת NF-? B. יתר על כן, Nrf2? /? עוברי פיברובלסטים של עכברים שטופלו ב- LPS ו- TNF-? להראות הפעלת NF-? B בולטת יותר הנגרמת על ידי הפעלת IKK ו- I? B-? השפלה [60]. ואיחוי נגיף הסינציטים הנשימתי פוחת באופן משמעותי בעוד שפעילות קשירת ה- DNA של NF-? B מוגברת ב- Nrf2? /? עכברים בהשוואה לעכברי WT [93]. דלקת ריאות זאבת הנגרמת על ידי טרום ב- Nrf2? /? לעכברים שטופלו יחד עם סולפוראפאן יש נזק חמור לכליות ושינויים פתולוגיים וכן ביטוי מוגבר ל- iNOS והפעלת NF-? B בהשוואה ל- WT, מה שמרמז כי Nrf2 משפר את דלקת הלופוס על ידי עיכוב מסלול האיתות של NF-? B וניקוי ROS [94] ]. פעילות NF-? B מתרחשת גם כאשר מטפלים בתאים במזרז Nrf2 יחד עם LPS ו- TNF- ?. לדוגמא, נגזרת כלקון סינתטית מעכבת הפעלת NF-? B המושרה על ידי TNF - באופן ישיר ועקיף ובחלקו באמצעות אינדוקציה של ביטוי HO-1 בתאי HT-29 של האפיתל במעי האנושי [62]. דיכוי טרנסלוקציה של NF-? B ופעילות מחייבת DNA כמו גם דיכוי ביטוי ה- iNOS בהפטוציטים, כאשר חולדות F344 מטופלות ב- 3H-1,2-dithiole-3-thione (D3T) [95]. לאחר טיפול משותף עם סולפוראפן ו- LPS, הביטוי המושרה על ידי LPS של iNOS, COX-2 ו- TNF-? ב- Raw 264.7 מקרופאגים מוסדר למטה, והציע כי לסולפוראפן יש פעילות אנטי דלקתית באמצעות עיכוב של קשירת DNA ל- NF-? B [96]. למרות שנעשו מספר מחקרים ניסיוניים כדי להסביר את הקשר בין מסלולי ה- Nrf2 ו- NF-? B, נותרו תוצאות סותרות. שני תקנות חיוביות ושליליות דווחו בין Nrf2 לבין NF-kB [97]. בדרך כלל, אלקטרוכימים chemopreventive 3H-1,2-dithiole-3-thione, sulforaphane ו- Triterpenoid CDDO-Me מפעילים את Nrf2 על-ידי עיכוב NF-kB וגנים מדוכאים [98], [99], [100]. לעומת זאת, מספר סוכנים או תנאים כגון ROS, LPS, מתח גזירה, LDL מחומצן ועשן סיגריות הוכחו על מנת להגביר את פעילות Nrf2 ו- NF-kB [97]. בנוסף, מחקרים in vivo גילו שפעילות NF-kB פוחתת בכבד המבודד מ- Nrf2? /? עכברים ופעילות קשירת NF-? B נמוכה יותר ב- Nrf2? /? מאשר בעכברים Nrf2 + / + [101]. עם זאת, תאי אנדותל אבי העורקים האנושיים שטופלו בווקטור אדנו-ויראלי Nrf2 מעכבים גנים במורד הזרם של NF-? B מבלי להשפיע על פעילותם של NF-? B [8].

איור 4 לולאה רגולטורית של Nrf2 ו- NF-? B. מסלול Nrf2 מעכב הפעלת NF-? B על ידי מניעת השפלה של I? B-? והגברת הביטוי של HO-1 והגנת נוגדי חמצון המנטרלים ROS וכימיקלים הרעלים. כתוצאה מכך, ההפעלה של NF-? B הקשורה ל- ROS מדוכאת. כמו כן, שעתוק בתיווך NF-? B מפחית את הפעלת ה- Nrf2 על ידי צמצום AREתמלול גנים וחלבון מחייב CREB חופשי על ידי התחרות עם Nrf2 על CBP. יתר על כן, NF-? B מגדיל את הגיוס של היסטון דיאצטילאז (HDAC3) לאזור ARE ומכאן שנמנע הפעלת תעתיק Nrf2.
ד"ר חימנז לבן מעיל
ההפעלה של נתיב איתות Nrf2 משחק תפקיד מרכזי בביטוי של אנזימים וגנים המעורבים דטוקסיפיקציה של חמצון תגובתי על ידי שיפור יכולת נוגדת חמצון של התאים בגוף האדם. בעוד מחקרים רבים זמינים כיום, מנגנוני הרגולציה ההפעלה Nrf2 אינם מובנים לחלוטין. תפקיד אפשרי של נתיב איתות Nrf2 בטיפול בדלקת נמצא גם. ד"ר אלכס Jimenez DC, תובנה CCST

תפקידו של Nrf2 במחלות דלקתיות

ב vivo מחקרים הראו כי Nrf2 ממלא תפקיד חשוב מחלות דלקתיות המשפיעות על מערכות שונות; אלה כוללים דלקת קיבה, קוליטיס, דלקת ריאות, דלקת ריאות, נזק כבד, מחלות לב וכלי דם, מחלות נוירודגנרטיבית, ונזק מוחי. במחקרים אלה, Nrf2? /? בעלי חיים הראו תסמינים חמורים יותר של דלקת ונזק לרקמות בהשוואה לחיות WT לכן, הוא האמין כי נתיב איתות Nrf2 יש השפעה מגנה על מחלות דלקתיות. התקנת Intra-tracheal של elastase הלבלב של חזירי גורמת למחלת ריאות חסימתית כרונית, במיוחד אמפיזמה. Nrf2 עכברים לקוי רגישים מאוד אמפיזמה, ירידה בביטוי של HO-1, PrxI, ואת הגן antiprotease SLPI להתרחש מקרופאגים alveolar. Nrf2 נחשבת לרגולטור מרכזי במערכת ההגנה המקרופאגית נגד פציעה ריאה. Nrf2 עכברים לקוי עם אמפיזמה הנגרמת על ידי חשיפה לעישון טבק במשך 6 חודשים להראות עלייה בדלקת ברונכואלווארל, ביטוי upregulated של סמנים מתח חמצוני ב alveoli, והגדילה אפופטוזיס תא מחיצתי תאית, דבר המצביע על כך Nrf2 פועל נגד אמפתזמה הנגרמת על ידי טבק דרך ביטוי מוגבר של נוגדי חמצון גנים [102], [103]. עם הפרעה Nrf2, דלקת דרכי הנשימה אלרגיות באמצעות אסתמה באמצעות מופע מורכב ovalbumin הגביר דלקת דרכי הנשימה, hyperwayasia של תאים גביע, hyperlasia של תאים גביע, ואת רמות גבוהות של Th2 בשטיפה bronchoalveolar ו splenocytes, ואילו נתיב איתות Nrf2 בתיווך מגביל את דרכי הנשימה eosinophilia , רירית יתר של הריר ותגובת יתר של דרכי הנשימה, כמו גם יצירת גנים נוגדי חמצון רבים המונעים התפתחות של אסטמה [104]. הזרקת Carageenan לתוך חלל pleural גורם plorisy, ו 15d-PGJ2 הצטברות בתאי דלקת Nrf2 מוגבל רק מקרופאגים העכבר פריטוניאלית. במהלך השלב המוקדם של דלקת, 15d-PGJ2 מפעיל Nrf2 ו מסדיר את התהליך הדלקתי באמצעות אינדוקציה של HO-1 ו PrxI. מחקר גם הציע כי COX-2 יש השפעה אנטי דלקתית בשלב מוקדם על ידי הייצור של 15D-PGJ2 [105]. מינון אורלי של 1% dxtran sulfate sulfate עבור 1 שבוע גורם קוליטיס הקשורים שינויים היסטולוגית הכוללים קיצור של crypts וחדירה של תאים דלקתיים ברקמת המעי הגס. כדי להגן על שלמות המעיים בדלקת המעי הגס, Nrf2 יכול לשחק תפקיד חשוב על ידי ויסות ציטוקינים פרו דלקתיים וגורמת אנזימים שלב II detoxifying [51]. במודל עכבר מסוג Nrf2-knockout של אלח דם ריאתי המושרה על ידי LPS, פעילות NF-? B מווסתת את ההשפעה של ציטוקינים דלקתיים כגון COX-2, IL-113, IL-6 ו- TNF? שהם חיוניים ליזום ולקידום דלקת [60]. Nrf2 מפחית נזק דלקתי על ידי ויסות גורמים דלקתיים אלה. במודלים אלה של דלקת חריפה, הגדלת הרגולציה של אנזימים נוגדי חמצון, ציטוקינים פרו דלקתיים, ומגשרים על ידי נתיב איתות Nrf2 מפחית את הפגיעה בדלקת אצל בעלי חיים WT. מעניין, זה גם דווח בעכברים Nrf2-knockout שבו הסימפטומים הם החריפו במידה ניכרת לעומת עכברים WT.

מחקר על תרופות נוגדות דלקת Nrf2

לסיכום, יש לנו דנו ניסויים מראה כי נתיב האות Nrf2 משחק תפקיד רגולרי בתחומים רבים של דלקת, כך Nrf2 תלויי דלקת סוכנים חשובים לטיפול במחלות דלקתיות.

צמחים היו מקורות עשירים להפליא של תרכובות המפעילות Nrf2 גורם שעתוק, המוביל את הרגולציה למעלה של גנים cytoprotective. לאחרונה נערכו מספר מחקרים לבדיקת השפעתם של חומרים אנטי דלקתיים שונים, רובם ממוצא צמחי. לדוגמה, כורכום הוא המרכיב הפעיל של כורכום והוא נמצא גם בכמויות קטנות של זנגביל; isothiocyanates, במיוחד phenylisothiocyanates הם ברוקולי, סלרי, וירקות אחרים; ו אנתוציאנינים הם מן גרגרים וענבים [124]. מחקרים הראו כי כל הסוכנים האלה הם לא רק נוגדי חמצון טובים, אלא גם בעלי השפעות אנטי-דלקתיות חזקות באמצעות אינדוקציה של Nrf2 [125], [126]. לכן, פיתוח של אנטי-דלקתיים חדשים Nrf2 activators מן תמצית צמח משך הרבה עניין במחקר רפואי.

בשנים האחרונות נערכו ניסויים בבעלי חיים רבים כדי לאשר את פעולותיהם של תרכובות אלו. Artesunate משמש בעיקר למלריה קשה, מלריה מוחית ומחלות אוטואימוניות ראומטיות; זה יעיל גם בפגיעת ריאות ספיגה. Artesunate מפעיל ביטוי Nrf2 ו- HO-1, והאחרון מפחית את זרימתם של ציטוקינים פרו-דלקתיים ולוקוציטים לרקמות כדי למנוע דלקת [127]. איזוביטקסין, המופק מהקליפות של אורז סאטיבה, נחשב לתכונות אנטי דלקתיות ונוגדות חמצון; זה ממלא תפקיד מגן מפני פגיעה חריפה בריאה הנגרמת על ידי LPS על ידי הפעלת מסלול Nrf2 / HO-1 ועיכוב MAPK ו- NF-? B [128]. Fimasartan, חוסם קולטן אנגיוטנסין II פופולרי לאחרונה הפועל על מערכת הרנין-אנגיוטנסין, מפחית את לחץ הדם; שימוש ב- fimasartan לטיפול בעכברים עם חסימת שופכה חד-צדדית הניתנת לניתוח מפחית מתח חמצוני, דלקת ופיברוזיס באמצעות הגדלת מספר NRF2 ובדרך נוגדת החמצון ומעכב RAS ו- MAPKs [129]. ספאנון מופץ באופן נרחב בדרום מזרח אסיה, שם הוא משמש כתרופות נגד שפעת, אנטי אלרגיות ונוירו-מגן; הוא מפעיל את Nrf2 ומעכב NF-? B ולכן עשוי להועיל בטיפול במחלות הקשורות ל- Nrf2- ו / או NF-? B [130]. ביקסין המופק מזרעי Bixin orellana משמש למחלות זיהומיות ודלקתיות במקסיקו ובדרום אמריקה; זה מקטין מתווכים דלקתיים, דליפת נימים במכתשי, ונזקי חמצון באופן תלוי ב- Nrf2 כדי להקל על פגיעת ריאות הנגרמת על ידי אוורור ולהחזיר את מורפולוגיית הריאות הרגילה [131]. לתרכובות צמחיות אחרות, כגון תמצית אפיגלוקאטכין, סולפוראפאן, רזברטרול, ליקופן ותמצית תה ירוק יש השפעות טיפוליות על מחלות דלקתיות דרך מסלול האיתות Nrf2 [132], [133], [134]. לאחרונה דווח כי פיטוכימיה אחרת, אריודיקטיול, הקיימת בפרי הדר, השפעה אנטי דלקתית ונוגדת חמצון על פגיעת כליות הנגרמת על ידי ציספלטין ופציעת ריאות חריפה הנגרמת על ידי אלח דם על ידי ויסות Nrf2, עיכוב NF-? B ועיכוב ביטוי של ציטוקינים במקרופאגים [135], [136]. עם זאת, פיטוכימיקלים רבים מראים הבטחה רבה למניעה וטיפול במחלות אנושיות שונות, וחלקם כבר נכנסו לשלב הניסויים הקליניים (טבלה 2).

אלה תרכובות צמח להפעיל את נתיב איתות Nrf2 בעיקר בצורה של חומרים electrophilic לשנות את שאריות ציסטאין של Keap1, המוביל חינם Nrf2 גרעיני מחייב עם ARE, וכתוצאה מכך ההפעלה של שעתוק של הגן המתאים.

Sulforaphane והשפעותיו על סרטן, תמותה, הזדקנות, מוח והתנהגות, מחלות לב ועוד

Isothiocyanates הם כמה תרכובות צמח החשוב ביותר שאתה יכול לקבל בתזונה. בסרטון זה אני עושה את המקרה המקיף ביותר עבור אותם כי היה אי פעם. טווח קשב קצר? דלג לנושא המועדף עליך על ידי לחיצה על אחת מנקודות הזמן הבאות. ציר זמן מלא להלן.

מקטעי מפתח:

  • 00: 01 - סרטן ותמותה
  • 00: 19 - הזדקנות
  • 00: 26: 30 - המוח וההתנהגות
  • 00: 38 - סיכום סופי
  • 00: 40 - מינון

ציר זמן מלא:

  • 00: 00: 34 - מבוא של sulforaphane, מוקד עיקרי של הסרטון.
  • 00: 01: 14 - הצריכה של הצומח הצמח והפחתת בתמותה מכל הסיבות.
  • 00: 02 - סיכון לסרטן הערמונית.
  • 00: 02 - סיכון לסרטן שלפוחית ​​השתן.
  • 00: 02 - סרטן הריאה אצל מעשנים מסתכן.
  • 00: 02 - סיכון לסרטן השד.
  • 00: Hypothetical: מה אם כבר יש לך סרטן? (התערבות)
  • 00: 03: 35 - מנגנון מתקבל על הדעת המניע את הנתונים התמותה הסרטן ותמותה.
  • 00: 04 - Sulforaphane וסרטן.
  • 00: 05: 32 - ראיות לבעלי חיים המראים השפעה חזקה של ברוקולי לנבוט לחלץ על התפתחות שלפוחית ​​השתן בעכברים.
  • 00: 06 - השפעת תוסף ישיר של sulforaphane בחולי סרטן הערמונית.
  • 00: 07: 09 - ביואקומולציה של מטבוליטים איסוציאיאנט ברקמת השד בפועל.
  • 00: 08: 32 - עיכוב של תאי גזע סרטן השד.
  • 00: 08: 53 - שיעור היסטוריה: brassicas הוקמו כבעלי תכונות בריאותיות גם ברומא העתיקה.
  • 00: 09 - היכולת של Sulforaphane כדי לשפר את הפרשת מסרטן (בנזין, acrolein).
  • 00: 09 - NRF51 כמתג גנטי באמצעות רכיבי תגובה נוגדי חמצון.
  • 00: 10 - כיצד NRF10 ההפעלה משפר הפרשת מסרטן באמצעות גלוטתיון- S-conjugates.
  • 00: 10: 34 - נבטים בריסל להגדיל גלוטתיון- S-transferase ולהפחית נזק ל- DNA.
  • 00: 11 - ברוקולי לנבוט משקה מגביר הפרשת בנזין על ידי 20%.
  • 00: 13: 31 - ברוקולי לנבוט homogenate מגביר אנזימים נוגדי חמצון בדרכי הנשימה העליונות.
  • 00: 15: צריכת הצליבה הצמחית ותמותה ממחלות לב.
  • 00: 16 - ברוקולי נובט אבקת משפר את רמת השומנים בדם ואת הסיכון למחלות לב כל סוג של חולי סוכרת מסוג 55.
  • 00: 19 - תחילת סעיף ההזדקנות.
  • 00: 19 - דיאטה עשירה ב- Sulforaphane משפרת תוחלת חיים של חיפושיות מ- 21 ל- 15% (בתנאים מסוימים).
  • 00: 20 - חשיבותה של דלקת נמוכה לאריכות ימים.
  • 00: 22: CROCiferous ירקות ברוקולי נבט אבקה נראה להקטין מגוון רחב של סמנים דלקתיים בבני אדם.
  • 00: 23: 40 - סיכום וידאו: סרטן, קטעים מזדקנים
  • 00: 24: 14 - מחקרים שנעשו על ידי עכברים מצביעים על כך ש- sulforaphane עשוי לשפר את תפקוד המערכת החיסונית הזקנה בגיל מבוגר.
  • 00: 25 - שיפור צבע השיער גדל במודל עכבר של מקריח. תמונה ב 18: 00: 26.
  • 00: 26 - התחלה של המוח והתנהגות סעיף.
  • 00: 27: 18 - השפעת ברוקולי לנבוט לחלץ על אוטיזם.
  • 00: 27: 48 - השפעת glucoraphanin על סכיזופרניה.
  • 00: 28: 17 - תחילת הדיון בדיכאון (מנגנון ומחקרים סבירים).
  • 00: 31 - מחקר עכבר באמצעות 21 דגמים שונים של לחץ המושרה על-ידי דיכאון הראה sulforaphane ביעילות דומה כמו fluoxetine (prozac).
  • 00: 32: 00 - מחקר מראה בליעה ישירה של glucoraphanin בעכברים הוא יעיל באופן דומה במניעת דיכאון מ תבוסה חברתית מודל הלחץ.
  • 00: 33 - תחילתו של קטע neurodegeneration.
  • 00: 33 - Sulforaphane ואלצהיימר.
  • 00: 33 - Sulforaphane ומחלת פרקינסון.
  • 00: 33 - Sulforaphane והונגטינגטון.
  • 00: 34: 13 - Sulforaphane מגביר את החלבונים בהלם חום.
  • 00: 34 - תחילתו של סעיף פגיעה מוחית טראומטית.
  • 00: 35: 01 - Sulforaphane מוזרק מיד לאחר TBI משפר זיכרון (מחקר העכבר).
  • 00: 35: 55 - Sulforaphane ופלסטיות עצבית.
  • 00: 36: 32 - Sulforaphane משפר את הלמידה במודל של סוכרת מסוג II בעכברים.
  • 00: 37: 19 - Sulforaphane ו Duchenne ניוון שרירים.
  • 00: 37: עיכוב מיוסטטין בתאי לווין שרירים (במבחנה).
  • 00 - 38: 06: סיבת וידאו מאוחרת: תמותה וסרטן, נזק ל- DNA, מתח חמצוני ודלקת, הפרשת בנזן, מחלות לב וכלי דם, סוכרת מסוג II, השפעות על המוח (דיכאון, אוטיזם, סכיזופרניה, ניוון מוחי), נתיב NRF2.
  • 00: 40 - מחשבות על חישוב מנה של נבטי ברוקולי או sulforaphane.
  • 00: 41: אנקדוטות על הנבטה בבית.
  • 00: על טמפרטורת בישול ופעילות sulforaphane.
  • 00: 43: 45 - חיידקי הבטן המרה של sulforaphane מ glucoraphanin.
  • 00: 44 - תוספי מזון טובים יותר בשילוב עם מירוזינאז פעיל מירקות.
  • 00: 44 - טכניקות בישול וירקות cruciferous.
  • 00: 46 - Isothiocyanates כמו goitrogens.

מסקנות

נכון לעכשיו, מחקרים רבים התמקדו בתפקיד מסלול האיתות Nrf2 / Keap1 / ARE בדלקת. בין האנזימים המווסתים על ידי Nrf2, HO-1 הוא אחד האנזימים המייצגים של תגובת לחץ. ל- HO-1 יש תכונות אנטי דלקתיות ונוגדות חמצון בולטות. באופן כללי, מסלול האיתות Nrf2 מווסת שלילית גם ציטוקינים, גורמים המשחררים כימוקינים, MMPs ומתווכים דלקתיים אחרים COX-2 וייצור iNOS, המשפיעים באופן ישיר או עקיף על מסלולי ה- NF-kB ו- MAPK ועל רשתות אחרות השולטות בדלקת. מוצע כי מסלולי האיתות Nrf2 ו- NF-? B מתקשרים כדי לווסת את התעתיק או הפונקציה של חלבוני יעד במורד הזרם. דיכוי או השבתה של פעילות תעתיק מתווכת NF-? B דרך Nrf2 מתרחשת ככל הנראה בשלב המוקדם של הדלקת, מכיוון שה- NF-? B מווסת את הסינתזה דה-נובו של מערך של מתווכים פרו-דלקתיים. עם זאת, עדיין קיימות מגבלות במחקר כמו האם ישנם קשרים בין Nrf2 למסלולי איתות אחרים כגון JAK / STAT, המשמעות של מפעילי ה- NRf2 הנוכחיים שמקורם במקורות צמחיים טבעיים בדלקת, וכיצד לשפר את הפעילות הביולוגית. ולשפר את המיקוד של תרכובות אלה. אלה דורשים אימות ניסיוני נוסף.

בנוסף, מסלול האיתות Nrf2 יכול לווסת> 600 גנים [163], מתוכם> 200 מקודדים לחלבונים ציטופרוטקטיביים [164] הקשורים גם לדלקת, סרטן, מחלות ניווניות ומחלות עיקריות אחרות [165]. עדויות הולכות וגדלות המצביעות על כך שמסלול האיתות של Nrf2 מוסדר בביטול סרטן רבים, וכתוצאה מכך סוללה גנטית תלויה ב- Nrf2 מתבטאת בסוטה. יתר על כן, דלקת משחקת תפקיד מרכזי במחלות הקשורות למתח חמצוני, במיוחד בסרטן. יישום של מספר מפעילי Nrf2 כדי לנטרל את הדלקת עלול לגרום לביטוי חריג של גנים Nrf2 במורד הזרם אשר גורם לאונקוגנזה ועמידות לטיפול כימותרפי ו / או רדיו. לכן, ניתן לפתח מפעילים ספציפיים מאוד של Nrf2 כדי למזער את השפעותיו הפליוטרופיות. כמה מפעילים של Nrf2 הראו שיפור משמעותי בתפקודים האנטי דלקתיים במחלות הקשורות למתח חמצוני. הדוגמה הטובה ביותר למפעיל Nrf2 המאושר על ידי ה- FDA ונמצאת בשימוש נרחב לטיפול במחלות דלקתיות כגון טרשת נפוצה (MS) היא דימתיל פומרט. Tecfidera (שם רשום של דימתיל פומרט על ידי Biogen) משמש ביעילות לטיפול בצורות חוזרות של טרשת נפוצה במספר גדול של חולים [152]. עם זאת, היעילות של שימוש במפעילי Nrf2 לטיפול במחלות דלקתיות דורשת אימות נוסף כדי למנוע את ההשפעות המזיקות של Nrf2. לכן, לפיתוח טיפולים לפעילות נגד דלקת המתווכת על ידי Nrf2 יכולה להיות השפעה קלינית משמעותית. מחקרים שוטפים על מסלול האיתות Nrf2 ברחבי העולם מוקדשים לפיתוח חומרים טיפוליים ממוקדים במיוחד כדי לשלוט בסימפטומים של דלקת ולמניעה וטיפול בסרטן וכן במחלות ניווניות ומחלות אחרות.

תודות

Sciencedirect.com/science/article/pii/S0925443916302861#t0005

לסיכום, Nrf2 חשים את רמות הלחץ החמצוני בגוף האדם ובסופו של דבר מסייע לקדם את הרגולציה של נוגדי חמצון ו detoxifying אנזימים וגנים. בגלל דלקת כרונית הנגרמת על ידי רמות גבוהות של מתח חמצוני קשורה למחלות ניווניות, Nrf2 יכול למלא תפקיד חיוני בטיפול בנושאי בריאות כמו מחלת אלצהיימר, בין היתר. היקף המידע שלנו מוגבל לבעיות בריאות כירופרקטיקה ובעמוד השדרה. כדי לדון בנושא, אל תהסס לשאול את ד"ר חימנז או ליצור איתנו קשר בכתובת 915-850-0900 .

אושר על ידי ד"ר אלכס Jimenez

הפניה מ: Sciencedirect.com

לחצן התקשרות הירוק H. PNG

נושא נוסף דיון: הקלה על כאבי ברכיים ללא ניתוח

כאבי ברכיים הם סימפטום ידוע שיכול להופיע בגלל מגוון פציעות ו / או מצבים בברך, כולל פציעות ספורט. הברך היא אחד המפרקים המורכבים ביותר בגוף האדם מאחר והיא מורכבת מהצטלבות של ארבע עצמות, ארבע רצועות, גידים שונים, שני מניסקיים וסחוס. על פי האקדמיה האמריקאית לרופאי משפחה, הגורמים השכיחים ביותר לכאבי ברכיים כוללים סובלוקסציה ברגליים, דלקת גידים ברגל או ברך מגשר ומחלת אוסגוד-שלאטר. למרות שכאב ברכיים סביר להניח להופיע אצל אנשים מעל גיל 60, כאבי ברכיים יכולים להופיע גם אצל ילדים ומתבגרים. ניתן לטפל בכאבי ברכיים בבית בשיטות ה- RICE, אולם פגיעות קשות בברכיים עשויות לדרוש טיפול רפואי מיידי, כולל טיפול כירופרקטי.

תמונה של הילד קריקטורה

EXTRA EXTRA | חשוב נושא: מומלץ אל Paso, TX Chiropractor

***

הבנת Nrf2 והשפעתה על מחלות נוירודגנרטיביות

הבנת Nrf2 והשפעתה על מחלות נוירודגנרטיביות

מחלות נוירודגנרטיביות, כגון מחלת אלצהיימר ומחלת פרקינסון, משפיעות על מיליוני אנשים ברחבי העולם. מגוון רחב של אפשרויות טיפול זמינים לטיפול בסימפטומים של מספר מחלות נוירודגנרטיבי למרות התוצאות מוגבלות לעתים קרובות. מחקרים מצאו כי מתח חמצוני הנגרם על ידי גורמים פנימיים וחיצוניים כאחד יכול להיות סיבה להתפתחות של מחלות נוירודגנרטיב. ה גורם תעתיק, Nrf2, נקבעה לתפקד כמנגנון הגנה מרכזי נגד לחץ חמצוני. מטרת המאמר להלן היא להראות את ההשפעות של Nrf2 על מחלות נוירודגנרטיביות.

אפנון Proteostasis על ידי גורם שעתוק NRF2

מחלות נוירודגנרטיביות קשורות להצטברות של אגרגטי חלבון ספציפיים, דבר המצביע על קשר אינטימי בין המוח הפגוע לבין אובדן הפרוטאוזאזיס. פרוטאוסטזיס מתייחס לכל התהליכים שבאמצעותם תאים לשלוט על שפע וקיפול של תודה proteome לרשת רחבה המשלבת את הרגולציה של נתיבי איתות, ביטוי גנים ומערכות חלבון השפלה. סקירה זו מנסה לסכם את הממצאים הרלוונטיים ביותר על אפנון תעתיק של proteostasis המופעל על ידי גורם שעתוק NRF2 (גורם גרעיני (נגזר erythroid 2) - כמו 2). NRF2 נחשב באופן קלאסי כווסת הראשי של התגובה התא נוגד חמצון, אם כי הוא מתגלה כיום כמרכיב מפתח של מכונות התמרה לשמור על פרוטאוזאזיס. כפי שנדון, NRF2 יכול להיות חזה כרכזת הידור אותות חירום שמקורם הצטברות חלבון misfolded על מנת לבנות תגובה תעתיק מתואמת perdurable. זו מושגת על ידי פונקציות של NRF2 הקשורים לשליטה של ​​גנים המעורבים תחזוקה של הפיזיולוגיה reticulum endoplasmic, proteasome ו autophagy.

מילות מפתח: מחלות נוירודגנרטיביות, תגובת חלבון שהתגלתה, פרוטאזום, יוביקוויטין, אוטופאגי, מתח חמצוני

קיצורים

Sciencedirect.com/science/article/pii/S2213231716304050

מבוא

גורם גרעיני (erythroid- נגזר 2) - כמו 2 (NRF2) הוא חלבון בסיסי- leucine-zipper נחשב כיום כווסת הורים של הומאוסטזיס הסלולר. הוא שולט על הביטוי הבסיסי והמתח של גנים של 250 שמשתפים במשותף משפר של cis-action שמגדיר את אלמנט התגובה נוגדי החמצון (ARE) [1], [2], [3], [4], [5]. גנים אלה משתתפים בתהליכי טיהור שלב I, II ו- III, גלוטתיון וחילוף חומרים peroxiredoxin / thioredoxin, ייצור NADPH דרך מסלול פוספט pentose ואנזים malic, חמצון חומצות שומן, מטבוליזם של ברזל ו- proteostasis [6]. בהתחשב בפונקציות cytoprotective רחב, זה אפשרי כי פגיעה פרמקולוגית אחת NRF2 עשוי למתן את ההשפעה של האשמים העיקריים של מחלות כרוניות, כולל מתח חמצוני, דלקתי ו proteotoxic. תפקידו של NRF2 ב אפנון ההגנה נוגדי חמצון ברזולוציה של דלקת טופלו במחקרים רבים (נבדק ב [7]). כאן, נתמקד בתפקידה בפרוטאוזאזיס, כלומר, השליטה ההומיאוסטית של סינתזת החלבון, קיפול, סחר והשפלה. דוגמאות יינתנו בהקשר של מחלות נוירודגנרטיביות.

אובדן פרוטאוסטזיס משפיע על פעילות NRF2 במחלות ניווניות

סימן ההיכר הכללי של מחלות ניווניות הוא התרחשות של צבירה חריגה של כמה חלבונים. לפיכך, אגרגטים של חלבונים מקופלים בצורה שגויה של? -סינוקליין (? -SYN) נמצאים במחלת פרקינסון (PD), פלאמי עמילואיד (A?) ובסבכים נוירו-פיברילריים TAU היפר-פוספוריליים במחלת אלצהיימר (AD), ציד (Htt) ב מחלת הנטינגטון (HD), סופרוקסיד דיסמוטאז 1 (SOD1) וחלבון TAR DNA מחייב 43 (TDP-43) בטרשת לרוחב amyotrophic (ALS), חלבון פריון (PrP) באנצפלופתיה ספוגיפורמית וכו '. אגרגטים לחלבון יכולים להשפיע על מספר מסלולים תאיים, אשר בתורם עשויים להשפיע על רמות NRF2 ופעילותם.

שכבות שונות של רגולציה הדוקה שליטה NRF2 פעילות

בתנאים פיזיולוגיים, התאים מפגינים רמות נמוכות של חלבון NRF2 בשל המחזור המהיר. בתגובה לגירויים שונים, NRF2 חלבון הוא צבר, נכנס לגרעין ומגביר את שעתוק של ARE המכילים גנים. לכן, ניהול של רמות חלבון NRF2 היא נקודת מפתח כי צריך לשלב אותות קלט חיוביים ושליליים. כפי שנדון עוד, NRF2 מופעל על ידי מנגנונים חופפים שונים כדי לתזמר תגובה מהירה ויעילה, אבל מצד שני, NRF2 יכול להיות מעוכב, כנראה בשלב השני, כדי לכבות את התגובה שלו.

מנקודת מבט קלאסית, הפעלת NRF2 נחשבה כתוצאה מהתגובה התאית לתרכובות חמצון או אלקטרופיליות. בהקשר זה, מתאם הליגאז של E-ubicitin E3, כמו חלבון 1 הקשור ל- ECH (KEAP1), ממלא תפקיד מכריע. פרטים מולקולריים יטופלו עוד בסעיף 4.1. בקצרה, KEAP1 משמש כחיישן חמצון עקב שאריות ציסטאין קריטיות המובילות לכל מקום בכל מקום ב- NRF2 והשפלה פרוטאזומלית. בנוסף לאופנון הקלאסי הזה, NRF2 מוסדר עמוקות על ידי איתות לאירועים. ואכן, הוכח כי קינאזות שונות זרחן ומווסתות את NRF2. לדוגמא, ניתן להזליף NRF2 על ידי קינאזות חלבון המופעלות על ידי מיטוגן (MAPK), אם כי תרומתו לפעילות NRF2 נותרה לא ברורה [8], [9], [10], [11]. PKA קינאז כמו גם כמה איזואימי PKC [12], CK2 [13] או Fyn [14] זרחן NRF2 המשנים את יציבותו. עבודה קודמת מקבוצתנו דיווחה כי גליקוגן סינטאז קינזה -3? (GSK-3?) מעכב את NRF2 על ידי הרחקה גרעינית והשפלה פרוטאזומלית [15], [25], [26], [27], [28], [29], [30]. הפרטים המולקולריים נדונו בסעיף 4.1. יתר על כן, NRF2 מוגש לסוגים אחרים של רגולציה. לדוגמא, אצטילציה של NRF2 על ידי CBP / p300 מגבירה את פעילותה [17], בעוד שהיא מעוכבת על ידי miR153, miR27a, miR142-5p ו- miR144 [16], או על ידי מתילציה של איי ציטוזין-גואנין (CG) בתוך היזם NRF2 [18].

השפעת מצרפי חלבון על מנגנוני NRF2 רגולטוריים

בפרק זה נתמקד איך הצטברות של חלבון misfolded יכול להשפיע על פעילות NRF2 לספק כמה מסלולים שהוזכרו לעיל כדוגמה ממחישה. ראשית, עלינו לשקול כי הצטברות חלבון כבר מקושר היטב עם נזק חמצוני. ואכן, הצטברות חלבון שגוי ו צבירה לגרום ייצור חריגה של מינים חמצן תגובתי (ROS) מ המיטוכונדריה ומקורות אחרים [19]. כפי שצוין לעיל, ROS ישנה ציסטאין רגישים-רגישים של KEAP1 המוביל לשחרור, ייצוב לוקליזציה הגרעין של NRF2.

באשר לפרוטאופתיה, דוגמה לאירועי איתות לא מוסדרים שעשויים להשפיע על NRF2 ניתנת על ידי הפעלת יתר של GSK-3? במודעה. GSK-3?, הידוע גם בשם TAU kinase, משתתף בזירחון של חלבון זה הקשור למיקרו-צינור, וכתוצאה מכך צבירתו, היווצרות סבכים נוירו-פיברריים והפרעה של הובלה אקסונלית (נסקרה ב [20]). מצד שני, GSK-3? מפחית באופן דרמטי את רמות ה- NRF2 ואת הפעילות כאמור לעיל. אף על פי שאינה מקובלת, מפל העמילואידים מציע כי A רעיל? אוליגומרים מגדילים את GSK-3? פעילות יחד עם היפר זרחון TAU ומוות נוירונים [21], [22]. ישנם מודלים שונים להסביר כיצד A? מעדיף GSK3-? פעילות. למשל, א? נקשר לקולטן האינסולין ומעכב את מסלולי איתות PI3K ו- AKT, שהם חיוניים לשמירה על GSK-3? הושבת על ידי זרחון בשאריות ה- Ser9 המסוף N שלו [23]. מצד שני, A חוץ תאי? מקיים אינטראקציה עם קולטנים מקורזללים, חוסם איתות WNT [24] ושוב וגורם לשחרור GSK-3 פעיל. לסיכום, א? הצטברות מובילה להפעלת יתר חריגה של GSK-3? ובכך פוגעת בתגובת NRF2 מתאימה.

כפי שפורט בסעיף הבא, חלבונים שגוי להוביל הפעלה של PERK ו MAPKs, אשר בתורו up- להסדיר NRF2 [31], [8], [9], [10], [11]. יתר על כן, dysregulated פעילות CBP / p300 דווחה במספר חלבונים [32] וכן ירידה עולמית במתילציה של דנ"א במוח AD הוצגה גם [33], ולכן מספק סיבות לחקור את הרלוונטיות של הממצאים הללו בתקנה NRF2.

אנו ואחרים ראינו בנקרוסים של חולי PD ו- AD עלייה ברמות החלבון של NRF2 וחלק מהמטרות שלו, כגון heme oxygenase 1 (HMOX1), NADPH quinone oxidase 1 (NQO1), p62 וכו ', הן על ידי immunoblot והן [34], [35], [36], [37], [38], [39]. תקנה של NRF2 במחלות אלה מתפרשת כניסיון לא מוצלח של המוח החולה לשחזר ערכים הומיאוסטטיים. עם זאת, מחקר אחר הראה כי NRF2 הוא מקומי בעיקר בציטופלסמה של נוירונים בהיפוקמפוס AD, דבר המצביע על הפחתת פעילות תעתיק NRF2 במוח [40]. סביר להניח כי הפער של תצפיות אלה קשורה לשינויים הגורמים השולטים NRF2 לאורך השלבים המתקדמים של neurodegeneration.

שלוש מערכות עיקריות תורמות לפרוטאוסטאזיס, דהיינו תגובת החלבון (UPR), מערכת הפרוטאזומה של יוביקוויטין (UPS) ואוטופאגי. הבא, אנו מציגים ראיות לחזות NRF2 כרכזת חיבור אותות חירום מופעל על ידי אגרגטים חלבון עם מכונות נגזרות חלבון.

NRF2 משתתפת בתגובת החלבון (UPR)

NRF2 הפעלה בתגובה UPR

קיפול חלבון חמצוני ב- ER מונע על ידי מספר מסלולים מובחנים, שהשימור בהם כולל את החלבון דיסולפיד-איזומרז (PDI) ואת הסולפידריל אוקסידאז האנדופלזמית אוקסידורדוקטין 1 (ERO1? ו- ERO1? אצל יונקים) כתורם דו-סולפיד. בקצרה, PDI מזרז היווצרות ושבירה של קשרי דיסולפיד בין שאריות ציסטאין בתוך החלבונים, כשהם מתקפלים, עקב הפחתה וחמצון של חומצות האמינו של ציסטאין משלה. מחזור ה- PDI ממוחזר על ידי פעולתו של אנזים ניקיון הבית ERO1, המחדיר מחדש קשרי דיסולפיד ל- PDI [41]. חמצן מולקולרי הוא מקבל האלקטרונים הסופי של ERO1, המייצר כמויות סטויוכיומטריות של מי חמצן עבור כל קשר דו-סולפיד המיוצר [42]. פרוקסידאזים (PRX4) ופרוטוקסידאזים של גלוטתיון (GPX7 ו- GPX8) הם אנזימים מרכזיים להפחתת מי חמצן במיון. כאשר מערכת זו המפחיתה את האוקסידו אינה פועלת כראוי, מתרחשת הצטברות חריגה של חלבונים מקופלים בצורה לא נכונה ומערך האותות בשם תגובת החלבון הנפרש (UPR) מועבר לציטופלזמה ולגרעין בכדי להקים מחדש את ההומאוסטזיס של ה- ER [43]. שלושה חלבונים הקשורים לקרום זוהו לחישת מתח ER באיקריוטים: הפעלת גורם שעתוק 6 (ATF6), ER eIF2 בלבלב? קינאז (PERK, גם חלבון כפול גדיל המופעל על ידי חלבון קינאז כמו קינאז ER), וקינאז 1 הדורש אינוזיטול (IRE1). התחום הלומינלי של כל חיישן קשור למלווה של 78 kDa המכונה חלבון מוסדר גלוקוז (GRP78 / BIP). BIP מתנתק ממתח ER כדי לקשור חלבונים פרושים, מה שמוביל להפעלת שלושת החיישנים [44].

NRF2 והומולוג שלו NRF1, הקשורים גם בתגובה נוגדי חמצון, להשתתף התמרה של UPR לגרעין. במקרה של NRF1, חלבון זה ממוקם בקרום ER ועובר טרנסלוקציה גרעינית על deglycosylation או מחשוף. לאחר מכן, הפעלה UPR מוביל לעיבוד של NRF1 ו הצטברות הגרעין של שבר שהתקבל בתא הגרעיני. עם זאת, היכולת להעביר את ARE המכילים את הגנים של קטע NRF1 זה עדיין תחת דיון [45].

Glover-Cutter ועמיתים לעבודה הראו הפעלה של אורתולוגיית NRF2 של C. elegans, SKN-1, עם מדחיפי ER שונים. ביטוי מוגבר של SKN-1 היה תלוי במתווכים שונים של UPR, כולל IRE1 או PERK תולעת [46]. ב PERK תאים לקוי, סינתזה חלבונים לקוי מוביל הצטברות של חמצן אנדוגני אפופטוזיס הבאים [47]. המפעיל המשמש את PERK להגנה על ה- ER מפרוקסידים אלה עשוי להיות NRF2, שכן הוא כבר דיווח כי PERK phosphorylates NRF2 ב Ser40, ובכך למנוע השפלה שלה על ידי KEAP1 [31]. אינדוקציה של ASK1 הוא גם עשוי לשחק תפקיד במסלול זה דרך הפעולה kinase TRF2 בתיווך של IRE1 [48]. למרות התפקיד של MAPKs בוויסות של NRF2 עדיין שנוי במחלוקת, הוצע לאחרונה כי מסלול IRE1-TRAF2-ASK1-JNK עשוי להפעיל NRF2 [49] (איור 1). מעניין, ב C. elegans ותאי אדם, ראיות חדשות עולה כי cystenylation cystenylation של IRE1 קינאז ב לולאה ההפעלה שלה מעכב IRE1 בתיווך UPR ויזם תגובה נוגדי חמצון p38 מונע על ידי NRF2. הנתונים מראים כי IRE1 יש פונקציה עתיקה כמו זקיף cytoplasmic המפעילה p38 ו NRF2 [50].

איור 1 תקנה של NRF2 על ידי UPR. הצטברות של חלבונים נפרשים או שגוי בתוך reticulum endoplasmic יכול ליזום את התגובה חלבון נפרש (UPR). ראשית, BIP המלווה הוא שוחרר מן התחום intraluminal של חיישנים ER IRE1 ו PERK לקשור נפרש / חלבונים misfolded. זה מאפשר dimerization ו trans-auto זרחון של תחומים cytosolic שלהם. תוצאות PERK מפעילות זרחן ישיר ב- NRF2 ב- Ser40, מה שמוביל ל NRF2 טרנסלוקציה לגרעין ולהפעלת גני מטרה. ההפעלה IRE1 גורם לגייס של TRAF2 ואחריו ASK1 ו זרחון JNK והפעלה. כפי JNK כבר דיווחו phosphorylate ולהפעיל NRF2, סביר לחשוב כי הפעלה IRE1 יוביל להגברת הפעילות NRF2.

מחקרים רבים על אינדוקציה של ה- UPR נערכו עם מעכב טוניקמיצין חלבון גליקוזילציה. נראה כי NRF2 חיוני למניעת מוות של תאים אפופטוטיים המושרה על ידי טוניקמיצין [31] והפעלתו בתנאים אלה מונעת על ידי השפלה אוטופגית של KEAP1 [51]. בהתאם, השתקה בתיווך shRNA של ביטוי NRF2 בתאי? TC-6, קו אינסולינומה עכברי? תאי, הגדילה משמעותית ציטוטוקסיות המושרה על ידי טוניקמיצין והביאה לעלייה בביטוי של סמן הלחץ החזותי פרו-אפופטוטי CHOP10. מאידך, הפעלת NRF2 על ידי 1,2-דיתיול-3-תיון (D3T) הפחיתה את הציטוטוקסיות של טוניקמיצין והחלישה את הביטוי של CHOP10 ו- PERK [52]. מעניין שנוירוני הריח שהוגשו ליישום מערכתי של טוניקמיצין הגבירו את ה- NRF2 במקביל לחברי UPR אחרים כגון CHOP, BIP, XBP1 [53]. תוצאות אלו הורחבו למחקרי in vivo, שכן עירוי חדרית של טוניקמיצין בחולדות גרם לביטוי של PERK ו- NRF2 בהיפוקמפוס מלווה בגירעונות קוגניטיביים משמעותיים, הגברת זרחון TAU והפקדות A? 42 [54].

NRF2 עד רגולציה מפתח גנים לתחזוקת הפיזיולוגיה של ER

לומן ה- ER זקוק לאספקה ​​בשפע של GSH מהציטוזול על מנת לשמור על הכימיה של דיסולפיד. NRF2 מווסת אנזימים מכריעים של חילוף החומרים של GSH במוח, כגון הובלת ציסטין / גלוטמט,? -גלוטמט ציסטאין סינטטאז (? -GS), גלוטמט-ציסטאין ליגאז קטליטי ותת יחידות (GCLC ו- GCLM), רדוקטאז גלוטתיון (GR) ו- גלוטתיון פרוקסידאז (GPX) (נבדק ב- [55]). הרלוונטיות של NRF2 לשמירה על GSH ב- ER נתמכת בממצא כי הפעלה פרמקולוגית או גנטית של NRF2 מביאה להגברת סינתזת GSH באמצעות GCLC / GCLM, תוך עיכוב של ביטוי האנזימים הללו על ידי מציאת NRF2 גרמה להצטברות של פגומים. חלבונים בתוך ה- ER המובילים להפעלת UPR [56].

ב- C. elegans כמה רכיבים של גני היעד UPR המווסתים על ידי SKN-1, כולל Ire1, Xbp1 ו- Atf6. אף על פי ש- NRF2 מווסת את הביטוי של כמה גנים של פרוקסידאז (PRX) וגלוטתיון פרוקסידאז (GPX) אצל יונקים (נבדק ב- [57]), רק GPX8 הוא אנזים ממוקד ER טוב, המאכלס את אות החזרת KDEL [58]. אובדן GPX8 גורם להפעלת UPR, לדליפה של מי חמצן שמקורם ב- ERO1? לציטוזול ולמוות תאים. מי חמצן שמקורם ב- ERO1? הפעילות אינה יכולה להתפזר מ- ER לציטוזול עקב הפעולה המתואמת של GPX8 ו- PRX4 [59]. בהקשר זה, ניתוח של מערך הביטוי הגנטי נוגדי חמצון-ביטוי גנים תוך שימוש ב- RNA מרקמות עכברים מסוג wild ו- NRF2-null, גילה כי הביטוי של GPX8 היה מוסדר למטה בהיעדר NRF2 [60]. בהתאם לכך, ניתוח תעתיק מדגימות מטופלים הסובלות ממיאופלזמות מיאלופרופירטיביות, פוליציטמיה או מיאלופיברוזיס, מחלות קשורות גם למתח חמצוני ודלקת כרונית בדרגה נמוכה, מראות רמות ביטוי נמוכות יותר של NRF2 והן של GPX8 בהשוואה לנבדקי ביקורת [61]. עדיין אין מחקרים הכוללים GPX8 באופן ספציפי בהגנה על המוח האנושי אך ניתוח תעתיק בעכברים מצביע על עלייה מפצה של GPX8 בתגובה לרעלן הפרקינסוני MPTP [62].

השפעת NRF2 על Dysregulation UPR במחלות ניווניות (Neurodegenerative Diseases)

תקלה באנזימים PDI ובפעילות כרונית של ה- UPR עשויה ליזום או להאיץ את ההתפתחות הנוירו-התפתחותית. נוירונים מושפעים ממחלות, מודלים של בעלי חיים למחלות נוירודגנרטיביות, כמו גם רקמות אנושיות שלאחר המוות, העידו על רגולציה של מספר סמני UPR ברוב הפרעות אלו. שינוי של PDI / UPR מסלול במחלות ניווניות נבדק יפה ב [63] אבל את הנקודות הבאות מדגימות המוח שלאחר המוות יש לשקול. רמות PDI מוגברות נוירונים נושאי סבך ובגופים Lewy של AD וחולים PD, בהתאמה [64], [65]. PDI ו- ERP57 מוסדרים למעלה ב- CSF מחולי ALS ובמוחות ממקרי CJD [66], [67], [68]. BIP, PERK, IRE1 ו- ATF6 מוגברות בדגימות מחולים עם AD, PD או ALS [69], [70], [71], [67]. BIP, CHOP ו XBP1 מוגבהים בדגימות מוח לאחר המוות מ HD [72], [73]. יתר על כן, למעלה רגולציה של ERP57, GRP94 ו- BIP נמצא ברקמות קליפת המוח מחולי CJD [74]. בסך הכל, עדות זו מגלה כי הצטברות של חלבונים misfolded ב parenchyma במוח מוביל הפעלה מזיקה כרונית של UPR. מעניין, יש לאחרונה מחקר המקשר הפעלה של NRF2 ידי PERK בתחילת לספירה. במחקר זה, החוקרים ניתחו האם שינויים מתחיים חמצוניים משתנים ב- NRF2 ו- UPR עשויים להוות אירועים מוקדמים ב- AD פתוגנזה באמצעות תאי דם היקפיים אנושיים ומודל עכבר מהונדס AD בשלבי מחלה שונים. מתח מוגבר חמצון מוגברת pSer40-NRF2 נצפו בתאי אדם monopuclear הדם ההיקפיים מבודד אנשים עם ליקוי קוגניטיבי קל. יתר על כן, הם דיווחו על לקוי של סידן הומוסקסואליות של סידן ER וסמלים של לחץ מסוג ER במחלות אלו מאנשים עם פגיעה קוגניטיבית קלה ו- AD [75].

הרגולציה ההדדית של NRF2 ושל פרוביזום Ubiquitin S (UPS)

UPS מודולציה NRF2 רמות חלבון

ה- UPS משתתף בהידרדרות של חלבונים פגומים או מטופלים ושולט על רמות המולקולות הרגולטוריות העיקריות בציטוזול ובגרעין. הליבה המרכזית של מערכת זו היא אנזים multisubunit גדול המכיל קומפלקס פעיל proteolytic בשם 20S. פרוטאזום הליבה של 20S מבזה חלבונים שהתפתחו, אך מחייב למרכיבי חלבון רגולטוריים שונים משנה את סגוליות המצע ואת פעילותו. לדוגמה, תוספת של אחת או שתיים יחידות משנה רגולטוריות של 19S לליבת 20S מהווה את הפרוטאזום 26S ומשנה את הייחודיות שלו כלפי חלבונים מקופלים ילידים [76], [77]. השפלה פרוטאזומלית צריך מחייב קוולנטי של יוביקוויטין. הצמדה של יוביקוויטין מתקדמת באמצעות מנגנון של שלושה צעדים מפל. ראשית, האובייקט המפעיל את היוביקובין E1 מפעיל את היוביקטינים בתגובת ה- ATP. לאחר מכן, אנזים E2 אחד (חלבון יוביקטינים או יוביקטינים-אנלוגי) מעביר את היוביקטינים המופעלים מ- E1 אל המצע המחובר באופן ספציפי לחולה של משפחת ליגאז 'של יוביקוויטין-חלבון, הנקראת E3. למרות הגורל המדויק של חלבון מיובש יהיה תלוי בטבע של שרשרת יוביקוויטין, תהליך זה בדרך כלל התוצאות השפלה על ידי xNUMXS 26S [78].

E3-ligase KEAP1 הוא המעכב הידוע ביותר של NRF2. מנגנון של רגולציה KEAP1 מסביר באלגנטיות כיצד רמות NRF2 להסתגל תנודות חמצון. בתנאים הבסיסיים, NRF2 מסונתז החדש נלכד על ידי ההומודימר KEAP1, המחבר מולקולה אחת של NRF2 בשני רצפי חומצות אמינו עם זיקה נמוכה (אספרטט, לאוצין, גליצין, DLG) וגבינה גבוהה (גלוטמט, threonine, גליצין, גלוטמט, ETGE). האינטראקציה עם עזרים KEAP1 כדי להציג NRF2 ל CULLIN3 / RBX1 חלבון מורכבים, וכתוצאה מכך obiquitination שלה והשפלה proteasomal הבאים. עם זאת, שינוי התיקון של KEAP1 מעכב את ההצגה של NRF2 ל- UPS המיוצגת על ידי CULLIN3 / RBX1. כתוצאה מכך, NRF2 synthetized החדש בורח השפלה תלויי KEAP1, מצטבר בגרעין ומפעיל גנים המכילים ARE [79], [80], [81], [82].

מתאם E3-ligase? -TrCP הוא גם הומודימר שמשתתף באירועי האיתות הקשורים לזרחן של NRF2 על ידי GSK-3 ?. קינאז זה מזרז שאריות סרין ספציפיות של NRF2 (אספרטט, סרין, גליצין, איזולאוצין סרין; DSGIS) ליצירת תחום השפלה שזוהה אז על ידי? -TrCP ומתויג להתדרדרות פרוטאזום על ידי קומפלקס CULLIN1 / RBX1. הזיהוי של חומצות האמינו הספציפיות שמזורזנות על ידי GSK-3? בדגרון זה נערך על ידי שילוב של מוטגנזה מכוונת אתרים של תחום Neh6, אלקטרופורזה דו-ג'ל [2], [15] וספקטרוסקופיית מסה [26]. כתוצאה מכך, עיכוב של GSK-83? על ידי תרופות או siRNAs סלקטיביות ביותר כנגד איזופורמי GSK-3 הביאו לעלייה ברמות החלבון NRF3. תוצאות דומות נמצאו עם siRNAs כנגד isoforms 2 ו- 1 -TrCP. ייצוב NRF2 בעקבות GSK-2? עיכוב התרחש בפיברובלסטים של העובר בעכבר חסר KEAP3 ובמוטציה של מחיקת NRF1 שבאה לידי ביטוי חסרת שרידי ה- ETGE הקריטיים לקשירה גבוהה לזיקה ל- KEAP2, והדגימה עוד יותר ויסות בלתי תלוי ב- KEAP1.

בהקשר של מחלות ניווניות ניווניות, אנו יכולים לחזות את האפנון של NRF2 על ידי ה- UPS בשתי דרכים שונות. מצד אחד, מערכת KEAP1 תחוש בחוסר איזון חיזור שמקורו בהצטברות חלבונים מקופלת באופן שגוי, בעוד שציר GSK-3 /? - TrCP ישמש כמשתתף פעיל בהעברת איתות שהשתנה על ידי אובדן פרוטוסטאזיס (איור 2).

איור 2 ה- UPS שולט בחוזקה ברמות NRF2. בתנאים הומאוסטטיים, רמות NRF2 נמוכות נשמרות על ידי פעולתם של מתאמי הליגאזות E3 KEAP1 ו-? -TrCP. משמאל, NRF2 נקשר לתחומי הקלץ 'של הומודימר KEAP1 באמצעות מוטיבים של זיקה נמוכה (DLG) ומוטי (ETGE) גבוהים. באמצעות תחום ה- BTB שלה, KEAP1 נקשר בו זמנית למתחם CULLIN3 / RBX1, מה שמאפשר NRF2 בכל מקום והשפלה על ידי פרוטאזום ה- 26 S. יתר על כן, GSK-3? זרחן שאריות Ser335 ו- Ser338 של NRF2 ליצירת תחום השפלה (DpSGIpSL) שזוהה אז על ידי מתאם הליגאז של היוביקוויטין? -TrCP ומתויג להתדרדרות פרוטאזום על ידי מתחם CULLIN3 / RBX1. מימין, עם חשיפה למיני חמצן תגובתי או לאלקטרופילים, משתנים שאריות Cys קריטיות ב- KEAP1, מה שהופך את KEAP1 ללא יכולת לקיים אינטראקציה יעילה עם NRF2 או CULLIN3 / RBX1 ואז גורם תעתיק זה מגדיל את מחצית החיים שלו ואת פעילות התעתיק כלפי ARE- גנים. מסלולי איתות המביאים לעיכוב של GSK-3 ?, זרחון AKT כזה ב- Ser9, מביאים לפגיעה בהידרדרות NRF2 על ידי הפרוטאזום, הצטברות ואינדוקציה של גני יעד.

NRF2 מגביר פעילות UPS באמצעות בקרת תעתיק של יחידות פרוטאזום

NRF2 מווסת את הביטוי של כמה יחידות תת פרוטאזום, וכך מגן על התא מפני הצטברות חלבונים רעילים. נראה כי עשרים גנים הקשורים לפרוטאזום ובכל מקום מווסתים על ידי NRF2, על פי ניתוח מיקרו מערך רחב מ- RNA כבד שהוקם עם ה- NRF2 המשרה D3T [84]. במחקר אחורי, אותם מחברים הראו כי הביטוי של רוב יחידות המשנה של הפרוטאזום 26S שופר עד פי שלושה בכבדים מעכברים שטופלו ב- D3T. רמות החלבון של יחידת המשנה ופעילות הפרוטאזום הועלו באופן מתואם. עם זאת, לא נראה אינדוקציה בעכברים שבהם גורם השעתוק NRF2 הופרע. פעילות היזם של יחידת המשנה PSMB5 (20S) פרוטאזום גדלה עם ביטוי יתר של NRF2 או טיפול עם מפעילים בפיברובלסטים עובריים של העכבר, ו- AREs זוהו במקדם הפרוקסימלי של PSMB5 [85]. הפעלה פרמקולוגית של NRF2 הביאה לרמות ביטוי מוגברות של יחידות משנה פרוטאזומיות מייצגות (PSMA3, PSMA6, PSMB1 ו- PSMB5) רק בפיברובלסטים אנושיים שאינם מבוגרים המכילים NRF2 תפקודי [86]. הפעלת NRF2 במהלך ההסתגלות למתח חמצוני גורמת לביטוי גבוה של PSMB1 (20S) ו- PA28? יחידות משנה (או S11, ויסות פרוטאזום) [87]. יתר על כן, תוצאות מתאי גזע עובריים אנושיים גילו כי NRF2 שולט בביטוי של חלבון ההבשלה הפרוטאזום (POMP), מלווה פרוטאזום, אשר בתורו מווסת את התפשטות תאי הגזע העובריים האנושיים המחדשים את עצמם, שלוש בידול שכבות נבט ותכנות מחדש של התא [ 88]. בסך הכל, מחקרים אלה מצביעים על כך ש- NRF2 מווסת את הביטוי של מרכיבי המפתח של ה- UPS ולכן תורם באופן פעיל לפינוי חלבונים שאחרת היו רעילים.

NRF2-UPS ציר במחלות ניווניות

תפקידו של UPS במחלות נוירודגנרטיביות הוא תחום של דיון אינטנסיבי. מחקרים ראשוניים דיווחו על ירידה בפעילות הפרוטאזום בנקרופים אנושיים של חולים שנפגעו ממחלות ניווניות שונות. עם זאת, מחקרים אחרים המעסיקים במבחנה ובגישות vivo נמצא ללא שינוי או אפילו פעילות proteasome מוגברת (נבדק ב [89]). הסבר אפשרי אחד לפער זה הוא שרמות רכיבי UPS עשויות להשתנות במהלך התקדמות המחלה ובאזורי מוח שונים כפי שהוצע עבור מטרות NRF2.

למרות מחלוקת זו, יש לציין כי up-regulation של ARE המכילים גנים proteasome יחזק את UPS על ידי הגדלת סליקה של חלבונים רעילים במוח. ואכן, אבלציה של NRF1, גם אפנן של התגובה נוגדת חמצון, בתאים העצבית מוביל לפעילות proteasome פגום neurodegeneration. ניסויים immunoprecipitation הכרומטין וניתוח תמליל הוכיחו כי PSMB6 מוסדר על ידי NRF1. בנוסף, פרופיל ביטוי גנים הוביל לזיהוי של NRF1 כווסת תמלילי מרכזי של גנים פרוטאזומיים בנוירונים, דבר המצביע על כך שהפרעות ב- NRF1 עשויות לתרום למחלה של מחלות נוירודגנרטיביות [90]. מעניין ש- NRF1 והאיזופורם הארוך הנקרא TCF11 הראו עד ויסות של גנים של פרוטאזום המכילים ARE על עיכוב פרוטאזומי בלולאת משוב כדי לפצות על פעילות פרוטאוליטית מופחתת [91], [92].

לגבי NRF2, יש מתאם בין הפחתת NRF2, RPT6 (19 S) ו PSMB5 (20 S) רמות של המוח התיכון של עכברים DJ-1 חסרים מטופלים עם parququat neurotoxin [93]. יתר על כן, המתחם המתרחש באופן טבעי sulforaphane (SFN) נותן תמונה חזקה יותר של NRF2 כמו אפנן מכריע של UPS. בניסויים חוץ גופית עם תאים נוירובלסטומה Murine Neuro2A תאים הוכיח ביטוי משופר של יחידות משנה קטליטי של proteasome, כמו גם פעילות peptidase שלה בתגובה SFN. זה התרופה מוגן תאים מימן חמצן בתיווך cytotoxicity וחמצון חלבון באופן תלוי פונקציה proteasome [94]. בנוסף, ליו ועמיתים לעבודה העסיקו עכבר עיתונאי כדי לפקח על פעילות ה- UPS בתגובה ל- SFN במוח. עכברים אלה בכל מקום להביע את החלבון הקרינה הירוקה (GFP) התמזגו אות השפלה מכוננת המקדמת השפלה מהירה על ידי UPS (GFPu). ב קליפת המוח, SFN הפחית את רמת GFPu עם עלייה מקבילה ב chymotrypsin כמו (PSMB5), כמו caspase (PSMB2), ו טריפסין כמו (PSMB1) פעילויות של פרוטאסום 20 S. בנוסף, טיפול של הנטינגטון נגזרות תאים עם SFN גילה כי הפעלת NRF2 משופרת השפלה mHtt מופחת cytotoxicity mHtt [95]. המנגנון העיקרי של פעולת SFN הוא באמצעות אינדוקציה של NRF2 [96]. התרומה הספציפית של NRF2 צריכה להתייחס לשימוש במערכות NRF2-null במחקרים נוספים.

חיבור פונקציונלי בין NRF2 ו Macroautophagy

NRF2 רמות חלבון מאופננים על ידי חלבון מתאם P62

Autophagy מתייחס השפלה של מרכיבים cytosolic בתוך lysosomes. תהליך זה משמש לניקוי של חלבונים ארוכי טווח ו misfolded כמו גם פגום האברונים. קישור ישיר בין NRF2 לבין autophagy נצפתה לראשונה בחלבון המתאם p62, המכונה גם SQSTM1 [97], [98], [99], [100], [101]. חלבון זה מעביר חלבונים מיובאים כדי machinsies השפלה פרוטאזומאלית ו lysosomal ו sequesters פגומים חלבונים לתוך אגרגטים לפני השפלה שלהם. P62 מציג תחום הקשור ל- Ubiquitin (UBA), המחייב חלבונים הנמצאים בכל מקום, ואזור אינטראקציה LC3 (LIR) לאינטגרציה עם הממברנה האוטופגוזומלית דרך הקולטן האוטופאגי LC3.

למרות שהאינדוקציה בתיווך p62 של NRF2 וגני היעד שלו דווחה לראשונה בשנת 2007 [102], המנגנון המולקולרי לא הובן במלואו עד לגילוי האינטראקציה שלו עם KEAP1 [103], [98], [99], [100 ], [101]. Komatsu ועמיתים לעבודה זיהו אזור אינטראקציה של KEAP1 (KIR) ב- p62 שקשר את KEAP1 באותו כיס משטח בסיסי כמו NRF2 ועם זיקה מחייבת הדומה למוטיב ETGE ב- NRF2, דבר המצביע על תחרות בין p62 ל- NRF2. ההזרחה של Ser351 במוטיב KIR ב- p62 (349-DPSTGE-354) הוכחה כמגבירה את זיקתה ל- KEAP1, ומתחרה בכריכת NRF2 ומאפשרת הצטברותה והפעלת תעתיק של גני היעד שלה [98], [99]. למעשה, ביטוי יתר של p62 הוביל להפחתת הנפקות של NRF2 ולהתייצבות כתוצאה מכך, כמו גם אינדוקציה של גני היעד שלו [104]. הוצעו כמה קינאזות להשתתף בזרחון p62. היעד של יונקים של קומפלקס רפמיצין 1 (mTORC1) עשוי להיות מעורב, מכיוון שטיפול במעכב mTOR רפמיצין דיכא את הזרחון של p62 ואת הסדרת ה- KEAP1 כלפי מטה לאחר טיפול בארסניט. לאחרונה הוכח כי TGF -? - מופעל קינאז 1 (TAK1) יכול גם לפוספורילציה של p62, דבר המשפר את ההשפלה של KEAP1 ואת ויסות NRF2. מחברי מחקר זה מציעים שזו דרך לווסת את הרדוקסטזיס הסלולרי בתנאים של מצב יציב, שכן מחסור ב- TAK1 מעלה את ויסות ה- ROS בהיעדר חמצון אקסוגני ברקמות עכבר שונות במקביל להפחתה ברמות החלבון NRF2 [105 ].

מבנה p62 חסר תחום UBA היה מסוגל עדיין מחייב KEAP1, מרמז כי האינטראקציה לא תלויה keAP1 ubiquitinated [101]. עם זאת, ההומולוג p62 ב תסיסנית melanogaster, בשם Ref (2), אינו מכיל מוטיב KIR ואינו אינטראקציה ישירה עם DmKEAP1, למרות שזה יכול להיקשר dmKEAP1 מיובאים באמצעות תחום UBA. יתר על כן, DmKEAP1 יכול לתקשר ישירות עם Atg8 (הומולוג כדי LC3 יונקים). חסר KEAP1 תוצאות Atg8 ו autophagy אינדוקציה תלויה NRF2 אורטולוג CncC ו עצמאית על TFEB / MITF [106]. הקשר בין NRF2 לבין autophagy נראה כי נשמר, המדגיש את הרלוונטיות הפונקציונלית שלו.

אינדוקציה של NRF2 על ידי p62 הוא תוצאה של שני המתחרים לאגד KEAP1 ו השפלה של KEAP1 ב lysosome. השתקת p62 עם siRNA הכפילה את מחצית החיים של KEAP1 במקביל לירידה ב- NRF2 ובגני המטרה שלו [101]. בהסכמה, אבלציה של ביטוי p62 הוכיח רמות גבוהות של KEAP1 לעומת עכברים סוג בר. רלוונטי מאוד, את תוספת KEAP1 רמות לא הושפע מעכבי proteasome אבל צומצם תחת autopagy רעב רעב [107]. למעשה, KEAP1 נמצא בתאי יונקים ב שלפוחית ​​אוטופגית מעוטרת עם p62 ו LC3 [99], [100], [103]. כל הנתונים הללו מציעים כי KEAP1 הוא מצע של מכונות macroautophagy, אבל בעיה זו יש לנתח עם פירוט רב יותר בגלל קיומו של כמה תוצאות שנויות במחלוקת. KEAP1 רמות החלבון גדלו בעכברים Atg7-null, גורם מפתח של macroautophagy [107], אך עיכוב תרופתי של macroautophagy עם torin1, E64 / pepstatin או bafilomycin לא הצליחו לצבור KEAP1 [107], [100]. בסך הכל, תוצאות אלה מרמזות כי רמות p62 מוגברת לשרש KEAP1 לתוך vacuoles autophagic וכנראה תוצאות אלה השפלה autopagic KEAP1 המאפשר הפעלה NRF2 (איור 3). שני מחקרים שונים דיווחו כי החומצה הגופרית מפחית את הסיכון של SESTRINS לתפקיד חשוב בהקשר זה. SESTRIN 2 אינטראקציה עם p62, KEAP1 ו RBX1 ו מקל על השפלה תלוי p62 של הפעלה KEAP1 ו NRF2 של גנים היעד [108]. מחקר נוסף הראה כי SESTRIN 2 אינטראקציה עם ULK1 ו p62, קידום זירזון של p62 ב Ser403 אשר הקל על השפלה של חלבונים המטען כולל KEAP1 [109].

איור 3 רמות NRF2 מוסדרים על ידי p62 חלבון מתאם. זרחון של סר 351 ב מוטיב KIR של p62 (349-DPSTGE-354) על ידי mTORC1, TAKXNXX או קינאזות אחרות תוצאות זיקה מוגברת מחייב KEAP1 בשל הדמיון מוטיב ETGE ב NRF1. כתוצאה מכך, p2 phosphorylated מחליף NRF62 וקושר KEAP2. מוטיב LIR ב p1 מאפשר אינטראקציה עם LC62 בקרום האוטופגוסומלי, כך p3-KEAP62 מורכבים בסופו של דבר מושפל הליזוזום. כתוצאה מכך NRF1 הוא מסוגל לצבור, translocate לגרעין ולהגדיל את שעתוק של גנים המכילים ARE, כולל p2. מנגנון רגולציה זה מספק תגובה NRF62 ניכרת, שכן KEAP2 צריך להיות מסונתז החדש על מנת לעכב פעילות NRF1.

אפנון של גנים Macroautophagy ידי NRF2

NRF2 מסדיר את הביטוי של גנים רלוונטיים עבור macroautophagy, כמו גם עבור UPR ו- UPS. הראיות הראשונות הגיעו ממחקרים שבהם הביטוי p62 הוצג כגורם לחשיפה ל electrophiles, ROS ו תחמוצת החנקן [110], [111], [112]. המנגנון של אינדוקציה תוארה כמה שנים מאוחר יותר עם המסקנה כי p62 מכיל פונקציונלי ARE האמרגן הגן שלה [99]. במחקר שנערך לאחרונה, כמה תפקודים אחרים נמצאו ו תוקף לאחר ניתוח ביואינפורמטיקה בדיקות CHIP. יתר על כן, fibroblasts עובריים עכבר נוירונים קליפת המוח מ Nrf2- נוקאאוט עכברים הציג ביטוי p62 מופחת, אשר ניתן להציל עם lentivirus NRF2- להביע. באופן דומה, חסר NRF2 הפחית רמות p62 נוירונים נפצעו עכברים בהיפוקמפוס [36]. לכן, הוצע כי NRF2 ההפעלה מגבירה את רמות p62, וכתוצאה מכך השפלה KEAP1 ו העדפה נוספת ייצוב NRF2 ב לולאה משוב חיובי. מנגנון לא קנוני זה של אינדוקציה NRF2 מחייב שינויים בביטוי גנים, ועשוי להיות תגובה רלוונטית למתח מתמשך של תאים סלולריים.

חלבון זיהוי המטען NDP52 הוכח להיות מוסדר transcriptionally ידי NRF2. NDP52 עובד באופן דומה p62, זיהוי חלבונים מיובאים אינטראקציה עם LC3 דרך תחום LIR, כך המטענים מושפלים ליזוזומים. חמש משוערות AREs נמצאו Ndp52 רצף DNA רצף. שלושה מהם זוהו עם קונסטרוקציות מוטנטיות שונות ובדיקות שבב כבלתי נמנעות עבור תעתיק NRF2 בתיווך Ndp52 [113]. ראוי לציין, רמות NRp52 mRNA הופחתו בהיפוקמפוס של עכברים Nrf2-knockout. אחד sequences אלה היה גם תוקף במחקר עצמאי כמו NRF2- מוסדר ARE [36].

עם זאת, תפקידו של NRF2 ב אפנון של autophagy אינו מוגבל אינדוקציה של שני אלה חלבונים הכרה. כדי לקבל תובנה עמוקה יותר בתפקיד של NRF2 באפנון של גנים נוספים הקשורים ל- autophagy, הקבוצה שלנו בדקה את מסד הנתונים של הכרומטין immunoprecipitation ENCODE עבור שני חלבונים, MAFK ו- BACH1, המחייבים את ה- NRF2. באמצעות סקריפט שנוצר מתוך JASPAR של קונסנזוס ARE רצף, זיהינו מספר תחליפי AREs בגנים autophagy רבים. שתים עשרה רצפים אלה היו תוקף כמו NRF2 מוסדר AREs תשעה גנים autopagy, אשר הביטוי היה פחתה עכבר fibroblasts העובר של Nrf2- נוקאאוט עכברים אבל יכול להיות משוחזר על ידי וירוס lentivX NRF2. המחקר שלנו הראה ש- NRF2 מפעיל את הביטוי של כמה גנים המעורבים בשלבים שונים של התהליך האוטופאגי, כולל ייזום אוטופאגי (ULK1), זיהוי מטען (p62 ו- NDP52), היווצרות אוטופגוזום (ATG4D, ATG7 ו- GABARAPL1), התארכות (ATG2B ו- ATG5 ), ו autolysosome אישור (ATG4D). כתוצאה מכך, שטף autophagy בתגובה מי חמצן נפגם כאשר NRF2 נעדר [36].

הרלוונטיות של NRF2-Mediated Macroautophagy ביטוי גנים בהפרעות ניווניות

פגמים אוטופגים הוכח כממלא תפקיד חשוב במספר מחלות נוירודגנרטיביות [114] ואבלציה של אוטופאגי מוביל לניוון מוחי בעכברים [115], [116]. עכברים Atg7-knockout גילה כי חוסר autophagy תוצאות הצטברות p62 ב-הכללה חיובי גופים היוביקוויטין. KEAP1 היה משוחרר אלה גופים הכללה, המוביל ייצוב NRF2 ו אינדוקציה של גנים היעד [103]. חשוב לציין, הצטברות מוגזמת של p62 יחד עם חלבונים אוביקטיניטדה זוהו במחלות נוירודגנרטיביות, כולל AD, PD ו- ALS [117]. למעשה, נוירונים המבטאים רמות גבוהות של APP או TAU של חולי AD הביעו גם p62 ו- NRF2 גרעיני, דבר המצביע על ניסיונם להשפיל אגרגטים תוך-רחמיים באמצעות אוטופאגי [36].

מחסור ב- NRF2 מחמיר את צבירת החלבונים בהקשר לספירה. למעשה, רמות מוגברות של TAU זרחני ובלתי מסיס נמצאות בעכברי Nrf2- נוקאאוט, אם כי לא ניתן היה לזהות הבדל בפעילות קינאז או פוספטאז בהשוואה לרקע הטבעי [113]. חשוב לציין, כי הוכח כי NDP52 משתף פעולה עם TAU בתאי עצב עכבריים, ואינטראקציה ישירה בין phospho-TAU ו- NDP52 הוצגה על ידי ניסויים משותפים לאימונומנטריפולציה הן בעכברים והן בדגימות AD, והצביעו על תפקידה בהשפלת TAU מעניין שהשתקת NDP52, p62 או NRF2 בנוירונים הביאה לעלייה ב- phospho-TAU [113], [118]. יתר על כן, אגרגטים מוגדלים של APP תוך-עצביים נמצאו בהיפוקמפוס של APP / PS1? E9 עכברים כאשר NRF2 נעדר. זה נמצא בקורלציה עם סמני אוטופאגיה ששונו, כולל עלייה ביחס פוספו-mTOR / mTOR ו- phospho-p70S6k / p70S6k (המעיד על עיכוב אוטופגי), רמות מוגברות של טרום קתפסין D ומספר גדול יותר של גופים רב-מולקולריים [119]. בעכברים המבטאים יחד APP אנושי (V717I) ו- TAU (P301L), מחסור ב- NRF2 הוביל לרמות מוגברות של סך הכל ו- phospho-TAU בשבריר המסיס והגדלת אגרגטים של APP תוך-עצביים, יחד עם רמות עצביות מופחתות של p62, NDP52, ULK1, ATG5 ו- GABARAPL1. לוקליזציה משותפת בין חלבון המתאם p62 ל- APP או TAU צומצמה בהיעדר NRF2 [36]. בסך הכל, תוצאות אלו מדגישות את החשיבות של NRF2 באוטופגיה עצבית.

גורמים שונים שעתוק לפעול בקואורדינטות כדי לשנות את פרוטאוסטזיס

תחת מצב מצב יציב, proteostasis נשלטת באמצעות אינטראקציות חלבון חלבון שלאחר השינויים translational קבלת תגובה מהירה. עם זאת, הסתגלות תאית דורש תקנה תעתיק של UPR, UPS ו autophagy גנים. בהתחשב בכך שתאי עצב נשלחים ברציפות לעלבונות רעילות ברמה נמוכה, כולל מתח חמצוני ופרוטוקסי, חיזוק של פרוטאוזאזיס המושרה על ידי אפנון תעתיק עשוי לסייע במניעת התנוונות המוחית.

במקרה של UPR, ההפעלה של כל אחת משלוש הזרועות תוביל בסופו של דבר להשראה תעתיק של גנים מסוימים (שנבדקו ב- [43]). לדוגמה, מקטע ATF6 הנגזר (ATF6f) נקשר למרכיבי תגובה של מתח (ERSE) וגורם לביטוי של מספר גנים, כולל XBPI, BIP ו- CHOP. בנוסף, איתות PERK מוביל להפעלת גורם השעתוק ATF4, אשר שולט בביטוי של מספר גנים הקשורים ל- UPR וכמה אחרים, כולל גני המטרה NRF2 Hmox1 ו- p62. לבסוף, תוצאות IRE1 גורמות לדור של גורם שעתוק פעיל, שחובר XBP1 (XBP1), השולט בתעתיק של חלבונים המקודדים גנים המעורבים בקיפול חלבונים.

מצד שני, NRF1 הוכח להיות הכרחי ביטוי גנים proteasomal במוח, כמו עכברים Nrf1- נוקאאוט הציג ביטוי מופחת של גנים קידוד יחידות משנה שונות של הליבה 20S, כמו גם את מורכבות 19S הרגולציה יחד עם תפקוד proteasomal לקוי [90 ]. הן NRF1 והן NRF2 מתחברות לרצפי ARE באזורי היזם של גני המטרה שלה, דבר המצביע על כך שהן חופפות פעילויות תמלוליות, למרות שהן נבדלות במנגנונים הרגולטוריים שלהן ובלוקליזציה הסלולרית [120].

גורמי תעתיק של Forkhead תיבת O (FOXO) משפחה לשלוט על הביטוי של מספר רב של גנים הקשורים autophagy. בדומה למה שקורה עם NRF2, ישנם מספר רבדים של רגולציה על פעילותם של חברי FOXO, אשר יכולים להיגרם על לחץ תזונתי או חמצוני [121]. לבסוף, גורם שעתוק TFEB, נחשב הרגולטור הראשי של ביוגנזה ליזוזומלית, ממלא תפקיד מכריע ברגולציה של autophagy תחת מצבי לחץ תזונתי. לפיכך, עיכוב של mTORC1 מוביל טרנסלוקציה גרעינית של TFEB ו אינדוקציה של הביטוי של גנים autophagy [122].

בסך הכל, קיומו של הרגולטורים תעתיק שונים של machineries אלה גם מציע crosstalk ומנגנוני מיותר חלקית אשר עשוי להבטיח פרוטאוזיס בנסיבות שונות. לפיכך, NRF2 עשוי להיות תפקיד רלוונטי ברקמות התומכות ברמות גבוהות של לחץ חמצוני. לדוגמה, מתח חמצון המושרה NRF2 עשוי לפעול בתנאים עשירים מזין כדי transcriptionally up- להסדיר autophagy, בדומה למה שנמצא עבור TFEB תחת תנאי רעב. יתר על כן, המוח פועל בעיקר בתנאים מזינים עשירים, בהצבת NRF2 כמנגנון רלוונטי להפעיל autophagy בנוירונים.

מבטיח פוטנציאל טיפולי ל- NRF2 בחלבונים

בשנים האחרונות, חלה התקדמות רבה בידע של תפקידים רגולטוריים של UPR, UPS ו autophagy על פעילות NRF2, כמו גם את תמליל הדדי NRF2 בתיווך של רכיבים אלה שלוש מערכות. לכן, אפשרויות טיפוליות חדשות עלולות להתבסס על ניצול של NRF2 כווסת מכריע של שחרור חלבונים במחלות ניווניות.

עם זאת, שאלה מרכזית שנותרה היא האם יהיה שימושי או מזיק להגביר את רמות ה- NRF2 במוח. ניתוח נתונים אפידמיולוגיים עשוי לספק תשובה חלקית, מכיוון שהוא מצביע על כך שהגן NFE2L2 הוא פולימורפי ביותר וכמה פולימורפיזמים בודדים של נוקליאוטידים שנמצאים באזור הרגולציה של היזם שלו עשויים לספק מגוון של "פיזיולוגיות" בביטוי גנים ברמת האוכלוסייה וכמה הפלוטיפים. היו קשורים לירידה בסיכון ו / או הופעה מאוחרת של AD, PD או ALS [123]. יתר על כן, כפי שנדונו על ידי הייז ועמיתיו [124], לאפקט NRF2 עשויה להיות תגובה בצורת U, כלומר רמות נמוכות מדי של NRF2 עלולות לגרום לאובדן הגנת הציטוטים ולרגישות מוגברת ללחץ, בעוד שיותר מדי NRF2 עלול להפר את האיזון ההומאוסטטי כלפי תרחיש רדוקטיבי (מתח רדוקטיבי), שיעדיף קיפול שגוי של חלבונים וצבירה. רמות NRF2 נמוכות במוח תומכות ברעיון כי ויסות קל-עלול עשוי להספיק בכדי להשיג תועלת בתנאים פתולוגיים. למעשה, התפקיד המגן של הפעלת תרופת תאים NRF2 בתיווך של פינוי חלבונים הוצג בתרבית תאי ניוון עצבים שונים ובמודלים in vivo.

SFN הוא פעיל NRF2 תרופתי שהוכח כי הוא גורם לביטוי גנים פרוטאזומלי ואוטופגי [95], [36]. מעניין ש- Jo ועמיתיו הוכיחו כי SFN הפחיתה את רמות ה- TAU הזרחני והגדילה את Beclin-1 ו- LC3-II, דבר המצביע על כך שהפעלת NRF2 עשויה להקל על השפלה של חלבון רעיל זה באמצעות אוטופאגיה [113]. יתר על כן, השפלה של mHtt שופרה עם SFN, וזה הוחזר באמצעות שימוש ב- MG132, דבר המצביע על השפלה פרוטאזומלית של חלבון רעיל זה [95]. השפלה בתיווך אוטופאגי של TAU זרחני ובלתי מסיס דווחה עם הפיסטין הפלבנואיד האורגני. תרכובת זו הצליחה לגרום לאוטופאגיה על ידי קידום בו זמנית הפעלה וטרנסלוקציה גרעינית של TFEB ו- NRF2, יחד עם כמה מגני היעד שלה. תגובה זו נמנעה על ידי השתקת TFEB או NRF2 [125]. Bott ועמיתיו דיווחו על השפעות חיוביות של פעיל NRF2, NRF1 ו- HSF1 בו זמנית על רעילות חלבונים באטרופיית שרירים בעמוד השדרה והבולברית, הפרעה ניוונית ניוונית הנגרמת על ידי הרחבת חזרת CAG מקודדת פוליגלוטמין בה קיימים אגרגטי חלבון [126]. הפוטנציאל של הפעלת NRF2 לטיפול בהפרעות ניווניות הוכח באישור BG-12, הניסוח האוראלי של NRF2 המושרה דימתיל פומאראט (DMF), לטיפול בטרשת נפוצה [127], [128]. ההצלחה של DMF עם מחלות אוטואימוניות עם מרכיב דלקתי חזק מעידה על כך שמחלות ניווניות עשויות להפיק תועלת ממיקום תרופה זו. במחקר פרה-קליני שנערך לאחרונה על מודל? -Synucleinopathy של PD, DMF הוכח כמגן-נוירו, בין השאר בגלל זירוזו של אוטופאגיה [129]. מחקרים המדווחים על השפעות חיוביות של NRF2 על ניוון נוירוני אך לא מתמקדים בהשפעתו על פינוי חלבונים נמצאים בשפע עוד יותר (לסקירה מקיפה ראה [7]). זה די רלוונטי, מכיוון שהוא מדגיש את התהליכים המזיקים המרובים שניתן לכוון בו זמנית על ידי מכה אחת ב- NRF2, כולל מתח חמצוני, דלקת עצבית או תפקוד לקוי של המיטוכונדריה. עם זאת, יהיה צורך בעבודה עתידית כדי לקבוע בהחלט אם הפעלה תרופתית של NRF2 עשויה להיות אסטרטגיה תקפה כדי להקל על פירוק חלבונים רעילים במוח.

כפי שהוסבר קודם, החריף את GSK-3? דווח על פעילות במחלות ניווניות ניווניות והועלו השערות שכתוצאה מכך הפחתת NRF2 יכולה להיות אחראית חלקית לתוצאה המזוייעת. בתנאים פתולוגיים אלה, מעכבי GSK-3 יכולים גם לשתף פעולה בכדי להגביר את רמות ה- NRF2 ואת הפרוטוסטאזיס. ההשפעות המועילות של מעכבי GSK-3 דווחו במודלים שונים של ניוון עצבי, ויותר מעניין שהדחקת GSK-3 הוכח כמפחית את רמות החלבונים הרעילים [130], [131], [132], [133]. למרות שעדיין לא נצפו קשר ישיר בין עיכוב GSK-3 לבין ויסות תעתיק NRF2 של גנים המקדמים פרוטוסטאזיס, סביר להניח כי ויסות למטה של ​​פעילות GSK-3 יביא לעלייה ברמות NRF2, שבסופו של דבר תביא לחיזוק מחוזק. פרוטוסטאזיס.

פעילות התעתיק של NRF2 כמו גם יכולת התאים לשמור על פרוטוסטאזיס יורדת עם הגיל, גורם הסיכון העיקרי להתפתחות מחלות ניווניות. סביר לחשוב כי חיזוק NRF2 וכתוצאה מכך פרוטאוסטאזיס, לפחות, יעכב את הצטברותם של אגרגטי חלבונים וניוון עצבי. ואכן, טיפול בפיברובלסטים מזדקנים אנושיים עם חומצה 18--glycyrrhetinic (18? -GA) טריטרפנואיד קידם הפעלת NRF2, מה שהוביל לאינדוקציה פרוטאזום ותוחלת חיים משופרת. מחקר זה מצביע על כך שהפעלה תרופתית של NRF2 אפשרית גם בסוף החיים [86]. יתר על כן, מחקר מאוחר יותר הראה כי תרכובת זו תיווכה הפעלת SKN-1 והפעלת פרוטאזום ב- C.elegans עם השפעות מועילות על התקדמות AD במודלים של נמטודות רלוונטיות [134].

כל הדברים, NRF2 אינדוקציה של גנים הקשורים proteostasis נראה מועיל ב proteinopathies שונים.

Sulforaphane והשפעותיו על סרטן, תמותה, הזדקנות, מוח והתנהגות, מחלות לב ועוד

Isothiocyanates הם כמה תרכובות צמח החשוב ביותר שאתה יכול לקבל בתזונה. בסרטון זה אני עושה את המקרה המקיף ביותר עבור אותם כי היה אי פעם. טווח קשב קצר? דלג לנושא המועדף עליך על ידי לחיצה על אחת מנקודות הזמן הבאות. ציר זמן מלא להלן.

מקטעי מפתח:

  • 00: 01 - סרטן ותמותה
  • 00: 19 - הזדקנות
  • 00: 26: 30 - המוח וההתנהגות
  • 00: 38 - סיכום סופי
  • 00: 40 - מינון

ציר זמן מלא:

  • 00: 00: 34 - מבוא של sulforaphane, מוקד עיקרי של הסרטון.
  • 00: 01: 14 - הצריכה של הצומח הצמח והפחתת בתמותה מכל הסיבות.
  • 00: 02 - סיכון לסרטן הערמונית.
  • 00: 02 - סיכון לסרטן שלפוחית ​​השתן.
  • 00: 02 - סרטן הריאה אצל מעשנים מסתכן.
  • 00: 02 - סיכון לסרטן השד.
  • 00: Hypothetical: מה אם כבר יש לך סרטן? (התערבות)
  • 00: 03: 35 - מנגנון מתקבל על הדעת המניע את הנתונים התמותה הסרטן ותמותה.
  • 00: 04 - Sulforaphane וסרטן.
  • 00: 05: 32 - ראיות לבעלי חיים המראים השפעה חזקה של ברוקולי לנבוט לחלץ על התפתחות שלפוחית ​​השתן בעכברים.
  • 00: 06 - השפעת תוסף ישיר של sulforaphane בחולי סרטן הערמונית.
  • 00: 07: 09 - ביואקומולציה של מטבוליטים איסוציאיאנט ברקמת השד בפועל.
  • 00: 08: 32 - עיכוב של תאי גזע סרטן השד.
  • 00: 08: 53 - שיעור היסטוריה: brassicas הוקמו כבעלי תכונות בריאותיות גם ברומא העתיקה.
  • 00: 09 - היכולת של Sulforaphane כדי לשפר את הפרשת מסרטן (בנזין, acrolein).
  • 00: 09 - NRF51 כמתג גנטי באמצעות רכיבי תגובה נוגדי חמצון.
  • 00: 10 - כיצד NRF10 ההפעלה משפר הפרשת מסרטן באמצעות גלוטתיון- S-conjugates.
  • 00: 10: 34 - נבטים בריסל להגדיל גלוטתיון- S-transferase ולהפחית נזק ל- DNA.
  • 00: 11 - ברוקולי לנבוט משקה מגביר הפרשת בנזין על ידי 20%.
  • 00: 13: 31 - ברוקולי לנבוט homogenate מגביר אנזימים נוגדי חמצון בדרכי הנשימה העליונות.
  • 00: 15: צריכת הצליבה הצמחית ותמותה ממחלות לב.
  • 00: 16 - ברוקולי נובט אבקת משפר את רמת השומנים בדם ואת הסיכון למחלות לב כל סוג של חולי סוכרת מסוג 55.
  • 00: 19 - תחילת סעיף ההזדקנות.
  • 00: 19 - דיאטה עשירה ב- Sulforaphane משפרת תוחלת חיים של חיפושיות מ- 21 ל- 15% (בתנאים מסוימים).
  • 00: 20 - חשיבותה של דלקת נמוכה לאריכות ימים.
  • 00: 22: CROCiferous ירקות ברוקולי נבט אבקה נראה להקטין מגוון רחב של סמנים דלקתיים בבני אדם.
  • 00: 23: 40 - סיכום וידאו: סרטן, קטעים מזדקנים
  • 00: 24: 14 - מחקרים שנעשו על ידי עכברים מצביעים על כך ש- sulforaphane עשוי לשפר את תפקוד המערכת החיסונית הזקנה בגיל מבוגר.
  • 00: 25 - שיפור צבע השיער גדל במודל עכבר של מקריח. תמונה ב 18: 00: 26.
  • 00: 26 - התחלה של המוח והתנהגות סעיף.
  • 00: 27: 18 - השפעת ברוקולי לנבוט לחלץ על אוטיזם.
  • 00: 27: 48 - השפעת glucoraphanin על סכיזופרניה.
  • 00: 28: 17 - תחילת הדיון בדיכאון (מנגנון ומחקרים סבירים).
  • 00: 31 - מחקר עכבר באמצעות 21 דגמים שונים של לחץ המושרה על-ידי דיכאון הראה sulforaphane ביעילות דומה כמו fluoxetine (prozac).
  • 00: 32: 00 - מחקר מראה בליעה ישירה של glucoraphanin בעכברים הוא יעיל באופן דומה במניעת דיכאון מ תבוסה חברתית מודל הלחץ.
  • 00: 33 - תחילתו של קטע neurodegeneration.
  • 00: 33 - Sulforaphane ואלצהיימר.
  • 00: 33 - Sulforaphane ומחלת פרקינסון.
  • 00: 33 - Sulforaphane והונגטינגטון.
  • 00: 34: 13 - Sulforaphane מגביר את החלבונים בהלם חום.
  • 00: 34 - תחילתו של סעיף פגיעה מוחית טראומטית.
  • 00: 35: 01 - Sulforaphane מוזרק מיד לאחר TBI משפר זיכרון (מחקר העכבר).
  • 00: 35: 55 - Sulforaphane ופלסטיות עצבית.
  • 00: 36: 32 - Sulforaphane משפר את הלמידה במודל של סוכרת מסוג II בעכברים.
  • 00: 37: 19 - Sulforaphane ו Duchenne ניוון שרירים.
  • 00: 37: עיכוב מיוסטטין בתאי לווין שרירים (במבחנה).
  • 00 - 38: 06: סיבת וידאו מאוחרת: תמותה וסרטן, נזק ל- DNA, מתח חמצוני ודלקת, הפרשת בנזן, מחלות לב וכלי דם, סוכרת מסוג II, השפעות על המוח (דיכאון, אוטיזם, סכיזופרניה, ניוון מוחי), נתיב NRF2.
  • 00: 40 - מחשבות על חישוב מנה של נבטי ברוקולי או sulforaphane.
  • 00: 41: אנקדוטות על הנבטה בבית.
  • 00: על טמפרטורת בישול ופעילות sulforaphane.
  • 00: 43: 45 - חיידקי הבטן המרה של sulforaphane מ glucoraphanin.
  • 00: 44 - תוספי מזון טובים יותר בשילוב עם מירוזינאז פעיל מירקות.
  • 00: 44 - טכניקות בישול וירקות cruciferous.
  • 00: 46 - Isothiocyanates כמו goitrogens.
ד"ר חימנז לבן מעיל
הגורם הגרעיני erythroid נגזר 2 (NF-E2) גורם מקושר 2, הידוע גם בשם Nrf2, הוא גורם שעתוק אשר מסדיר את הביטוי של מגוון של antioxidant ו detoxifying אנזימים. מחקרים הראו גם את תפקידה בשליטה על לחץ חמצוני. רוב מחלות העצבים, כגון מחלת האלצהיימר ומחלת פרקינסון, מאופיינות בלחץ חמצוני ודלקת כרונית, המטרות הנפוצות של שיטות הטיפול Nrf2. ד"ר אלכס Jimenez DC, תובנה CCST

הערות סיכום

גורם שעתוק NRF2 מנצח על תגובה פרוטוסטטית על ידי חישה ושינוי שינויים ב- UPR, UPS ו- autophagy (איור 4). כתוצאה מכך, היעדר NRF2 הוכח להחמיר פרוטאופאתיה, דבר המצביע על כך ש- NRF2 נחוץ לסילוק חלבונים אופטימלי. בסך הכל, אנו יכולים לשער כי NRF2 עשוי להיות יעד טיפולי מעניין עבור proteinopathies.

איור 4 NRF2 כמו רכזת חיבור proteotoxic נגזר אותות חירום לתגובה תגובת מגן. הצטברות של חלבונים נפרשים / misfolded יוביל ההפעלה של התגלו חלבון התגלו (UPR) בחדר מיון. הפעלה של PERK או MAPK עלולה לגרום לאינדוקציה של תעתיק ה- Gpx8 של ה- ER ומספר אנזימים המסדירים רמות GSH, קריטיים כדי להבטיח קיפול חלבונים נכון. פרוטאין אגרגטים לעכב פעילות proteasome (UPS), ככל הנראה הימנעות השפלה NRF2. NRF2 הוכח במיוחד כדי לשנות את תמלול של גנים PsMA3, Psma6, Psmb1, Psmb5 ו Pomp. כמה יחידות משנה אחרות היו למעלה מוסדר בצורה NRF2 תלויי בתגובה D3T, כנראה הגדלת רשימה של יחידות proteasome regulated ידי NRF2. Autophagy הוא המסלול העיקרי עבור השפלה של אגרגטים חלבון. Autophagy גם מסדיר את NRF2, חיבור זה נתיב השפלה עם NRF2 אינדוקציה תעתיק של p62, Ndp52, Ulk1, Atg2b, Atg4c, Atg5, Atg7 ו Gabarapl1.

תודות

Sciencedirect.com/science/article/pii/S2213231716304050

על פי המאמר לעיל, בעוד הסימפטומים של מחלות נוירודגנרטיב ניתן לטפל באמצעות מגוון רחב של אפשרויות הטיפול, מחקרים הראו כי הפעלה Nrf2 יכול להיות גישה טיפולית מועיל. כי Nrf2 פעילים מכוונים למנגנונים רחבים של מחלות, כל מחלות ניווניות ניווניות יכולות להפיק תועלת מהשימוש בגורם השעתוק Nrf2. הממצאים של Nrf2 חוללו מהפכה בטיפול במחלות ניווניות ניווניות. היקף המידע שלנו מוגבל לבעיות בריאות כירופרקטיקה ובעמוד השדרה. כדי לדון בנושא, אל תהסס לשאול את ד"ר חימנז או ליצור איתנו קשר ב 915-850-0900 .

אושר על ידי ד"ר אלכס Jimenez

הפניה ל:Sciencedirect.com

לחצן התקשרות הירוק H. PNG

נושא נוסף דיון: הקלה על כאבי ברכיים ללא ניתוח

כאבי ברכיים הם סימפטום ידוע שיכול להופיע בגלל מגוון פציעות ו / או מצבים בברך, כולל פציעות ספורט. הברך היא אחד המפרקים המורכבים ביותר בגוף האדם מאחר והיא מורכבת מהצטלבות של ארבע עצמות, ארבע רצועות, גידים שונים, שני מניסקיים וסחוס. על פי האקדמיה האמריקאית לרופאי משפחה, הגורמים השכיחים ביותר לכאבי ברכיים כוללים סובלוקסציה ברגליים, דלקת גידים ברגל או ברך מגשר ומחלת אוסגוד-שלאטר. למרות שכאב ברכיים סביר להניח להופיע אצל אנשים מעל גיל 60, כאבי ברכיים יכולים להופיע גם אצל ילדים ומתבגרים. ניתן לטפל בכאבי ברכיים בבית בשיטות ה- RICE, אולם פגיעות קשות בברכיים עשויות לדרוש טיפול רפואי מיידי, כולל טיפול כירופרקטי.

תמונה של הילד קריקטורה

EXTRA EXTRA | חשוב נושא: מומלץ אל Paso, TX Chiropractor

***

Nrf2 הסביר: נתיב Keap1-Nrf2

Nrf2 הסביר: נתיב Keap1-Nrf2

מתח חמצוני מתואר כנזק לתאים שנגרם על ידי רדיקלים חופשיים, או מולקולות בלתי יציבות, אשר בסופו של דבר יכול להשפיע על תפקוד בריא. גוף האדם יוצר רדיקלים חופשיים כדי לנטרל חיידקים ווירוסים, עם זאת, גורמים חיצוניים, כגון חמצן, זיהום, קרינה, לעתים קרובות גם לייצר רדיקלים חופשיים. מתח חמצוני נקשר עם בעיות בריאותיות רבות.

 

מתח חמצוני ודחקנים אחרים מפעילים מנגנוני הגנה פנימיים שיכולים לסייע לווסת את התגובה האנטי-אוקסידנטית של הגוף האנושי. Nrf2 הוא חלבון אשר חשים רמות של מתח חמצוני ומאפשר לתאים להגן על עצמם מפני גורמים פנימיים וחיצוניים. Nrf2 הוכח גם כדי לסייע לווסת את הגנים המעורבים בייצור של אנזימים נוגדי חמצון ו-תגובה גנים. מטרת המאמר להלן היא להסביר את ההשפעות של Nrf2 בסרטן.

 

תַקצִיר

 

המסלול Keap1-Nrf2 הוא הרגולטור העיקרי של התגובות cytoprotective כדי מתח חמצוני electrophilic. למרות מסלולי איתות תא מופעלות על ידי גורם שעתוק Nrf2 למנוע היזום סרטן והתקדמות ברקמות נורמלי preemignant, בתאי ממאיר מלא Nrf2 פעילות מספקת יתרון הצמיחה על ידי הגדלת chemoresistance סרטן ושיפור הגידול בתאי הגידול. בסקירה גרפית זו, אנו מספקים סקירה של מסלול Keap1-Nrf2 והדיסרגולציה שלו בתאי הסרטן. כמו כן, אנו מסכמים בקצרה את ההשלכות של הפעלת Nrf2 מכוננת בתאי הסרטן וכיצד ניתן לנצל זאת בטיפול גנטי בסרטן.

 

מילות מפתח: Nrf2, Keap1, סרטן, מרכיב נוגד חמצון, טיפול גנטי

 

מבוא

 

מסלול Keap1-Nrf2 הוא הרגולטור העיקרי של תגובות ציטוטרופנטטיביות למתח אנדוגני ואקסוגני הנגרם על ידי מיני חמצן תגובתי (ROS) ואלקטרופילים [1]. חלבוני האיתות המרכזיים במסלול הם גורם השעתוק Nrf2 (גורם גרעיני ל- erythroid 2 הקשור לגורם 2) הנקשר יחד עם חלבוני Maf קטנים לאלמנט התגובה נוגד החמצון (ARE) באזורים המווסתים של גני היעד, ו- Keap1 (Kelch ECH חלבון מקשר 1), חלבון מדכא הנקשר ל- Nrf2 ומקדם את פירוקו במסלול הפרוטאזום של היוביקוויטין (איור 1). Keap1 הוא חלבון עשיר מאוד בציסטאין, Keap1 בעכבר כולל סך של 25 ושאריות ציסטאין של בני אדם 27, שאת רובם ניתן לשנות במבחנה על ידי חמצון ואלקטרופילים שונים [2]. הוכח כי שלוש מהשאריות הללו, C151, C273 ו- C288, ממלאות תפקיד פונקציונלי על ידי שינוי הקונפורמציה של Keap1, מה שמוביל לטרנסלוקציה גרעינית של Nrf2 ולביטוי הגן היעד הבא [3] (איור 1). המנגנון המדויק שלפיו שינויים ציסטאניים ב- Keap1 מובילים להפעלת Nrf2 אינו ידוע, אך שני המודלים הרווחים אך לא בלעדיים הדדיים הם (1) מודל 'תליון ותפס', שבו שינויים ב- Keap1 בשאריות התיאול השוכנים ב- IVR של Keap1. לשבש את האינטראקציה עם Nrf2 וגורם לאי-יישור של שאריות הליזין בתוך Nrf2 שלא ניתן עוד לפוליביקוויטינילציה ו (2) המודל בו שינוי תיאול גורם לניתוק של Cul3 מ- Keap1 [3]. בשני הדגמים, Keap2 שהופעל על ידי גורם המושרה וה- Nrf1 אינו פעיל, וכתוצאה מכך חלבוני Nrf2 המסונתזים לאחרונה עוקפים את Keap1 ומתחלפים לגרעין, נקשרים ל- ARE ומניעים את הביטוי של גני היעד Nrf2 כגון NAD (P) H quinone oxidoreductase 1 (NQO1), heme oxygenase 1 (HMOX1), ליגאז גלוטמט-ציסטאין (GCL) וטרנספורז S של גלוטתיון (GST) (איור 2). בנוסף לשינויים בתאיולים של Keap1 וכתוצאה מכך אינדוקציה של גן היעד Nrf2, חלבונים כמו p21 ו- p62 יכולים להיקשר ל- Nrf2 או Keap1 ובכך לשבש את האינטראקציה בין Nrf2 ל- Keap1 [1], [3] (איור 3).

 

איור 1. מבנים של Nrf2 ו- Keap1 וקוד ציסטאין. (א) Nrf2 מורכב מ -589 חומצות אמינו ויש לו שישה תחומים שמורים מאוד מבחינה אבולוציונית, Neh1-6. Neh1 מכיל מוטיב bZip, אזור בסיסי רוכסן לאוצין (L-Zip), כאשר האזור הבסיסי אחראי להכרה ב- DNA וה- L-Zip מתווך דימריזציה בחלבוני מאף קטנים. Neh6 מתפקד כדגרון לתווך השפלה של Nrf2 בגרעין. Neh4 ו- 5 הם תחומי הפעלה. Neh2 מכיל מוטיבים של ETGE ו- DLG, הנדרשים לאינטראקציה עם Keap1, ואזור הידרופילי של שאריות ליזין (7 K), שהם הכרחיים עבור ה- polyubiquitination התלוי ב- Keap1 והשפלה של Nrf2. (ב) Keap1 מורכב מ -624 שאריות חומצות אמינו ויש לו חמישה תחומים. שני המוטיבים לאינטראקציה בין חלבונים, תחום BTB ותחום קלץ, מופרדים על ידי האזור המתערב (IVR). תחום ה- BTB יחד עם החלק הטרמינל N של ה- IVR מתווך הומודימריזציה של Keap1 וקשירה עם Cullin3 (Cul3). תחום Kelch והאזור המסוף C מתווכים את האינטראקציה עם Neh2. (C) Nrf2 מתקשר עם שתי מולקולות של Keap1 דרך מוטיבי Neh2 ETGE ו- DLG שלו. גם ETGE וגם DLG נקשרים לאתרים דומים על פני השטח התחתון של מוטיב Keap1 Kelch. (ד) Keap1 עשיר בשאריות ציסטאין, עם 27 ציסטאינים בחלבון אנושי. חלק מהציסטאינים הללו נמצאים בסמוך לשאריות בסיסיות ולכן הם יעדים מצוינים של אלקטרופילים ומחמצנים. דפוס השינוי של שאריות ציסטאין על ידי אלקטרופילים מכונה קוד ציסטאין. ההשערה של קוד ציסטאין מציעה שסוכני הפעלת Nrf2 שונים מבנית משפיעים על ציסטאינים שונים של Keap1. השינויים בציסטאין מובילים לשינויים קונפורמציים ב- Keap1 ומשבשים את האינטראקציה בין ה- Nrf2 DLG ו- Keap1 Kelch, ובכך מעכבים את הפוליביקווינטציה של Nrf2. החשיבות הפונקציונלית של Cys151, Cys273 ו- Cys288 הוצגה, שכן Cys273 ו- Cys288 נדרשים לדיכוי Nrf2 ו- Cys151 להפעלת Nrf2 על ידי מפעילים [1], [3].

 

איור 2. נתיב האיתות Nrf2-Keap1. (A ו- B) בתנאים הבסיסיים, שני מולקולות Keap1 לאגד Nrf2 ו Nrf2 הוא polyubiquitylated על ידי קומפלקס ליגאז E3 מבוסס Cul3. זה תוצאות polyubiquitilation ב Nrf2 השפלה מהירה על ידי proteasome. חלק קטן של Nrf2 נמלט מורכבות מעכב מצטבר בגרעין לתווך הבסיס ALE תלויי ביטוי גנים, ובכך לשמור על הומאוסטזיס הסלולר. (ג) תחת תנאי מתח, inducers לשנות את הציסטאין Keap1 המוביל את עיכוב של nrf2 ubiquitylation באמצעות ניתוק של מורכבות מעכב. (D) על פי הציר ואת מודל התפס, שינוי של שאריות ספציפיות Kep1 ציסטאין מוביל לשינויים קונפורמטיביים ב Keap1 וכתוצאה מכך ניתוק של מוטיב NRf2 DLG מ Keap1. Ubiquitination של Nrf2 הוא שיבשו אבל את הכריכה עם מוטיב ETGE נשאר. (E) ב מודל Keap1-Cul3 דיסוציאציה, הכריכה של Keap1 ו Cul3 הוא שיבשו בתגובה electrophiles, המוביל להימלטות של Nrf2 מן מערכת ubiquitination. בשני המודלים המוצעים, ה- inducer-moded ו- Nrf2, שקשורים ל- Keap1, מושבתים, וכתוצאה מכך, חלבונים Nrf2 מסונתזים חדשים עוקפים את Keap1 ומתרגמים לגרעין, נקשרים אל רכיב התגובה של נוגדי החמצון (ARE) ומניעים את הביטוי של היעד Nrf2 גנים כגון NQO1, HMOX1, GCL ו- GST [1], [3].

 

איור 3. מנגנונים של הצטברות גרעינית מכוננת של Nrf2 בסרטן. (א) מוטציות סומטיות ב Nrf2 או Keap1 לשבש את האינטראקציה של שני חלבונים אלה. ב Nrf2, מוטציות להשפיע מוטיבים ETGE ו DLG, אבל מוטציות Keap1 הם מופצים באופן שווה יותר. יתר על כן, הפעלה oncogene, כגון KrasG12D [5], או הפרעה של מדכאי הגידול, כגון PTEN [11] יכול להוביל אינדוקציה תעתיק של Nrf2 ועלייה Nrf2 גרעיני. (ב) Hypermethylation של האמרגן Keap1 בסרטן הריאה והערמונית מוביל להפחתת ביטוי mapNA Keap1, אשר מגביר את הצטברות הגרעין של Nrf2 [6], [7]. (ג) קרצינומה משפחתית פפילרית משפחתית, אובדן פעילות האנזים hydratase fumarate מוביל הצטברות של fumarate ועוד succination של שאריות ציסטאין Keap1 (2SC). שינוי זה שלאחר טרנסלציה מוביל שיבוש של אינטראקציה Keap1-Nrf2 ו הצטברות הגרעין של Nrf2 [8], [9]. (D) הצטברות של חלבונים משבש כגון p62 ו p21 יכול להפריע Nrf2-Keap1 מחייב ותוצאות גידול Nrf2 גרעיני. p62 נקשר Kep1 חופפים את כיס מחייב עבור Nrf2 ו p21 ישירות אינטראקציה עם DLG ו מוטי ETGE של Nrf2, ובכך להתחרות Keap1 [10].

 

מנגנוני הפעלה ו dysregulation של Nrf2 ב סרטן

 

למרות cytoprotection המסופק על ידי הפעלה Nrf2 חשוב chemoprevention סרטן ברקמות נורמלי ו premalignant, בתאי ממאיר מלא Nrf2 פעילות מספק יתרון הצמיחה על ידי הגדלת chemoresistance סרטן ושיפור גידול תאים סרטניים [4]. מספר מנגנונים שבהם נתיב איתות Nrf2 מופעל באופן קונסטרוקטיבי בסוגי סרטן שונים תוארו: (1) מוטציות סומטיות ב- Keap1 או בתחום החיבור Keap1 של Nrf2 שיבשו את האינטראקציה שלהם; (2) השתקה epigenetic של הביטוי Keap1 המוביל לדיכוי פגום של Nrf2; (3) הצטברות של חלבונים משבש כגון p62 המוביל דיסוציאציה של מורכבות Keap1-Nrf2; (4) אינדוקציה תעתיק של Nrf2 ידי oncogenic K-Ras, B-Raf ו- c-Myc; ו (5) שינוי לאחר טרנסלוציוני של ציסטאין Keap1 על ידי succinylation המתרחשת קרצינומה כלית פפילרי משפחתי עקב אובדן פעילות האנזים fomerate hydratase [3], [4], [5], [6], [7], [ 8], [9], [10] (איור 3). חלבון Nrf2 שופע בשפע גורם לעלייה בביטוי הגנים המעורבים בחילוף החומרים של התרופה ובכך מגביר את ההתנגדות לתרופות כימותרפיות ולהקרנות. בנוסף, רמה גבוהה של חלבון Nrf2 קשורה לפרוגנוזה גרועה בסרטן [4]. יתר על המידה Nrf2 משפיע גם על התפשטות תאים על ידי הפניית גלוקוז וגלוטמין לכיוון נתיבים אנאבוליים הגדלת סינתזת purine ולהשפיע על מסלול פוספט pentose לקדם שגשוג תאים [11] (איור 4).

 

איור 4. תפקיד כפול של Nrf2 ב tumorigenesis. בתנאים פיזיולוגיים, רמות נמוכות של Nrf2 גרעיני מספיקים לשמירה על הומאוסטזיס הסלולר. Nrf2 מעכב את גידולי הגידול ואת גרורות הסרטן על ידי חיסונים של חומרים מסרטנים, ROS וסוכני דנ"א אחרים. במהלך tumorigenesis, צבירת נזק ל- DNA מוביל היפראקטיביות מכוננת של Nrf2 המסייע תאים ממאירים אוטונומיים לסבול רמות גבוהות של ROS אנדוגני כדי למנוע אפופטוזיס. רמות Nrf2 גרעיניות גבוהות באופן מתמיד מפעילות גנים מטבוליים בנוסף לגנים הציטופרוטטיביים התורמים לתכנות מחדש מטבולי והתפשטות תאים משופרת. סרטן עם רמות Nrf2 גבוהות קשורות לפרוגנוזה גרועה בגלל רדיו chemoresistance ותאי גזע סרטניים תוקפניים. לפיכך, פעילות נתיב Nrf2 מגינה בשלבים המוקדמים של הגידול, אך מזיקה בשלבים מאוחרים יותר. לכן, למניעת סרטן, שיפור בפעילות Nrf2 נשאר בגישה חשובה ואילו לטיפול בסרטן, עיכוב Nrf2 הוא רצוי [4], [11].

 

בהתחשב בכך פעילות Nrf2 גבוהה מתרחשת בדרך כלל בתאי הסרטן עם תוצאות שליליות, יש צורך טיפולים כדי לעכב Nrf2. למרבה הצער, בשל הדמיון המבני עם כמה בני משפחה אחרים bZip, פיתוח של מעכבי Nrf2 ספציפיים היא משימה מאתגרת ורק כמה מחקרים על עיכוב Nrf2 פורסמו עד כה. על ידי הקרנת מוצרים טבעיים, רן et al. [12] זיהה ברוסאטול אנטי-פלואסטי של התרכובת כמעכב Nrf2 אשר מגביר את היעילות הכימותרפית של cisplatin. בנוסף, מעכבי PI3K [11], [13] ו- Nrf2 siRNA [14] שימשו לעכב Nrf2 בתאי הסרטן. לאחרונה, השתמשנו בגישה חלופית, הידועה כטיפול בגנים המתאבדים בסרטן, כדי למקד תאים סרטניים בעלי רמות Nrf2 גבוהות. Nrf2 וקטורים lentiviral מונע [15] המכיל thymidine קינאז (TK) מועברים לתוך תאים סרטניים עם פעילות גבוהה ARE והתאים מטופלים עם Pro-drug, ganciclovir (GCV). GCV הוא metabolized כדי מונופוספט GCV, שהוא phosphorylated נוסף על ידי קינאזות הסלולר לטופס triphosphate רעילים [16] (איור 5). זה מוביל להרוג יעיל לא רק TK המכילים תאים סרטניים, אלא גם את התאים השכנים בשל אפקט העוקב [17]. טיפול בגנים TK / GCV מוסדר יכול להיות משופר עוד יותר באמצעות שילוב של chemotherapeutic סוכן doxorubicin לטיפול [16], תמיכה ברעיון כי גישה זו יכולה להיות שימושית בשילוב עם טיפולים מסורתיים.

 

איור 5. התאבדות גנטית. הצטברות גרעינית Nrf2 מכוננת בתאים סרטניים יכולה להיות מנוצלת באמצעות וקטור ויראלי Nrf2 מונע לטיפול בגנים המתאבדים [16]. בגישה זו, וקטור lentiviral (LV) להביע תימידין קינאז (TK) תחת האמרגן SV40 מינימלי עם ארבע AREs הוא transduced לתאי ריאות אדנוקרצינומה. רמות גרעיניות גבוהות Nrf2 מובילות לביטוי איתן של TK דרך מחייב Nrf2. תאים מטופלים אז עם פרו סמים, ganciclovir (GCV), אשר phosphorylated על ידי TK. TriVosphorylated GCV משבש סינתזת DNA ומוביל להרוג יעיל לא רק TK המכילים תאים סרטניים, אלא גם את התאים השכנים בשל אפקט העוקב.

 

ד"ר חימנז לבן מעיל

Nrf2 הוא הרגולטור הראשי אשר מפעילה את הייצור של נוגדי חמצון רבי עוצמה בגוף האדם אשר מסייעים לחסל את הלחץ החמצוני. אנזימים נוגדי חמצון שונים, כגון superoxide dissutase, או SOD, גלוטתיון וקטליז, מופעלים גם הם במסלול Nrf2. יתר על כן, phytochemicals מסוימים כמו כורכום, ashwagandha, bacopa, תה ירוק, גדילן, להפעיל Nrf2. מחקרים מצאו כי הפעלה Nrf2 יכול באופן טבעי להגביר את ההגנה הסלולארית ולשחזר את האיזון לגוף האדם.

ד"ר אלכס Jimenez DC, תובנה CCST

 

Sulforaphane והשפעותיו על סרטן, תמותה, הזדקנות, מוח והתנהגות, מחלות לב ועוד

 

Isothiocyanates הם כמה תרכובות צמח החשוב ביותר שאתה יכול לקבל בתזונה. בסרטון זה אני עושה את המקרה המקיף ביותר עבור אותם כי היה אי פעם. טווח קשב קצר? דלג לנושא המועדף עליך על ידי לחיצה על אחת מנקודות הזמן הבאות. ציר זמן מלא להלן.

 

מקטעי מפתח:

 

  • 00: 01 - סרטן ותמותה
  • 00: 19 - הזדקנות
  • 00: 26: 30 - המוח וההתנהגות
  • 00: 38 - סיכום סופי
  • 00: 40 - מינון

 

ציר זמן מלא:

 

  • 00: 00: 34 - מבוא של sulforaphane, מוקד עיקרי של הסרטון.
  • 00: 01: 14 - הצריכה של הצומח הצמח והפחתת בתמותה מכל הסיבות.
  • 00: 02 - סיכון לסרטן הערמונית.
  • 00: 02 - סיכון לסרטן שלפוחית ​​השתן.
  • 00: 02 - סרטן הריאה אצל מעשנים מסתכן.
  • 00: 02 - סיכון לסרטן השד.
  • 00: Hypothetical: מה אם כבר יש לך סרטן? (התערבות)
  • 00: 03: 35 - מנגנון מתקבל על הדעת המניע את הנתונים התמותה הסרטן ותמותה.
  • 00: 04 - Sulforaphane וסרטן.
  • 00: 05: 32 - ראיות לבעלי חיים המר